|
Dig
|
 |
« Reply #200 on: March 22, 2009, 08:10:27 AM » |
|
This is not the first time that John D. Rockefeller IV let slip the nefarious NWO position of circumventing the constituion:~~~~~~~~~~~~~~~~~~ Sen. Rockefeller Lets Slip the Spying Truth: Drift Nets To Be Legalized http://www.infowars.com/sen-rockefeller-lets-slip-the-spying-truth-drift-nets-to-be-legalized/ Ryan Singel Wired February 05, 2008 In a Senate floor speech, Senator Jay Rockefeller (D-West Virginia) inadvertently made plain that the proposed changes to the nation’s spying laws radically expand how the government wiretaps inside the United States. Rockefeller was decrying an amendment that would require the government to discard non-emergency evidence if a court later finds that the spying methods violate the law. Rockefeller makes clear that the impending changes to the law aren’t about making it easier for the National Security Agency to listen in on a particular terrorism suspect’s phone calls. Instead, the changes are about letting the nation’s spooks secretly and unilaterally install filters inside America’s phone and internet infrastructure.
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
vladimir
Guest
|
 |
« Reply #201 on: March 22, 2009, 08:38:06 AM » |
|
(...) They all advance and learn and are "smart/inteligent/show leadership traits" in their respective niches but they are still stuck in their niche. (...) Joe live(s) in his box. Joe has decided this. Society has helped codify this decision that it itself essentially fostered.
(...) most people have no clue about computers or the internet.
(...) most people don't care about HOW the internet works. Just as long as they can send e-mail and go to myspace (...)
To them the internet is merely another thing that works- like TV and is just there..... (...)They wouldn't even have a clue what Jay was saying and most people would merely come away agreeing thinking Jay is some kind of IT guru.....
As, far as those in the know, they have all been conditioned to believe IPv6 is the way of the future. Thier leaders in the industry their Gurus - like Joe in our last story essentially- have said so. (...)
(...) We now live in a fledgling Technocracy that has evolved from this Nazi Kleptocracy that has been honed since it's inception at the end of WWII with operation paper clip.
The average Joe is a product of this society engineered for society by these evil Elite Overlords.
We, are the few who have stepped outside of the matrix. Those still plugged into the matrix won't see it till they are flushed out into reality . Even then it will take them a while to truly grasp what they truly are and what is truly going on in the world. Realize that the matrix is multi layered . You have been conditioned to go deeper into this onion every day of you life from birth till death. In order to actually truly see it you must first leave it by going the opposite direction you have been forced to travel.
(...)
Thank you for your excellent summary of the sad facts. I've been in and out of the IT industry for decades. But, if you don't keep up with the latest technology, you might as well be trying to live as a blacksmith. I used to keep up more with the debate about pidgeon-holing in the scientific-technical disciplines when I was working in universities -- attended some lectures about this, and scientists have been troubled how specialization is blinding everyone to the big picture for some time now. It certainly is the Matrix. Thanks also for posting Kagan's (and others' ?) working history of the CIA. One thing I'd take issue with, however... The People's Democratic Party (PDP) of Afghanistan enjoyed popular support, and this party under Babrak Kamal (according to an Afghan friend of mine the most universally respected man in Afghanistan) invited the Red Army into Afghanistan to help defend it against overthrow from the bandit warlords who had gotten the backing of the CIA to thwart the PDP's agrarian program and liberation of women from (non-Qur'anic) chattel slavery. While the Red Army had for decades served the foreign policy of the gravediggers of the Bolshevik Revolution who sat in the Kremlin, there was a tradition in the Russian military of international solidarity with peasants and workers of all countries that could never be entirely stamped out, and endured with the help of the Leninist rhetoric that the Kremlin masters counted on for popular support. This is the nature of Bonapartist regimes. Many genuine Marxists abroad were hoping that participation in the Afghan Revolution would re-invigorate the last vestiges of revolutionary Marxism in the military and eventually bring about a political revolution to end totalitarian rule in Russia. One could easily see the infinitely better condition of Islamic women in the Soviet Union, even under Stalin's heirs, when compared to their slave status in Afghanistan. Thousands of women educators and medical specialists are now refugees in India and other countries thanks to the "freedom fighters" which Carter and Brzezinski supplied with state-of-the-art weaponry in Afghanistan. You may have noticed that most, if not all, of the CIA's enemies in the backward countries of the First World were described as "communists". I say "First World" because, categorized as to whether capitalist or communist, they were not part of the Second World. The so-called "Third World" is under capitalist rule and so rightfully belongs to the First World. Haiti, for example, is under a capitalist regime. Now, these "communists" that the CIA went after were not helped in any appreciable way by the Kremlin, because the last thing the Kremlin bosses wanted was a successful Leninist revolution that would show them up as the frauds that they were. But these "communists" were not economic liberals either. Many may have been anarchists, but the majority were probably misguided Stalinists or reform-minded (not revolutionary-minded) social democrats of one stripe or another. Some few may have been genuine Leninists, but all were patriotic nationalists. Certainly the comprador middle-classes of these countries don't want their privileges taken away in any real proletarian social revolution. If you look at any reports of death-squad activity in Latin America, you'll find the CIA involved and you'll also find that their attacks are on union organizers who have ties to one or another Marxist political party. Now, if you peel the onion back a little, you'll see who globally are the real archenemies of the capitalist ruling classes that the CIA, MI-6, French Intelligence, the Mossad, the World Anti-Communist League, ad nauseam, are doing their dirty work for. If you take this a little further, you'll realize that there are well-funded organizations in the United States that keep the American workers and small farmers tied through billions of propaganda dollars to collusion with this global control of the world's labor markets to keep profits up by keeping labor in the so-called "Third World" cheap -- making Americans collaborators with global fascism or at least blinding them to it. Actually, the word "fascism" describes a more specific political dynamic, but I'll fudge a little here. I like your phrase "Nazi Kleptocracy": seems to fit the Global elite to a tee when you consider that the CIA and its sister organizations were products of the Anglo-American pact with late 20th-century Nazi Germany (the so-called Bundesrepublik) following the demise of Hitler. If all this sounds like Red propaganda, you should know that it's coming from someone who grew up a staunch anti-communist and even had trouble trying to learn Russian (linguistics is my main interest) because it stuck in the craw for the "evil commie language" I was constantly told it was as a young person.
|
|
|
|
|
Logged
|
|
|
|
|
Dig
|
 |
« Reply #202 on: March 22, 2009, 09:04:18 AM » |
|
Thank you for your excellent summary of the sad facts. I've been in and out of the IT industry for decades. But, if you don't keep up with the latest technology, you might as well be trying to live as a blacksmith. I used to keep up more with the debate about pidgeon-holing in the scientific-technical disciplines when I was working in universities -- attended some lectures about this, and scientists have been troubled how specialization is blinding everyone to the big picture for some time now. It certainly is the Matrix. Thanks also for posting Kagan's (and others' ?) working history of the CIA. One thing I'd take issue with, however... The People's Democratic Party (PDP) of Afghanistan enjoyed popular support, and this party under Babrak Kamal (according to an Afghan friend of mine the most universally respected man in Afghanistan) invited the Red Army into Afghanistan to help defend it against overthrow from the bandit warlords who had gotten the backing of the CIA to thwart the PDP's agrarian program and liberation of women from (non-Qur'anic) chattel slavery. While the Red Army had for decades served the foreign policy of the gravediggers of the Bolshevik Revolution who sat in the Kremlin, there was a tradition in the Russian military of international solidarity with peasants and workers of all countries that could never be entirely stamped out, and endured with the help of the Leninist rhetoric that the Kremlin masters counted on for popular support. This is the nature of Bonapartist regimes. Many genuine Marxists abroad were hoping that participation in the Afghan Revolution would re-invigorate the last vestiges of revolutionary Marxism in the military and eventually bring about a political revolution to end totalitarian rule in Russia. One could easily see the infinitely better condition of Islamic women in the Soviet Union, even under Stalin's heirs, when compared to their slave status in Afghanistan. Thousands of women educators and medical specialists are now refugees in India and other countries thanks to the "freedom fighters" which Carter and Brzezinski supplied with state-of-the-art weaponry in Afghanistan. You may have noticed that most, if not all, of the CIA's enemies in the backward countries of the First World were described as "communists". I say "First World" because, categorized as to whether capitalist or communist, they were not part of the Second World. The so-called "Third World" is under capitalist rule and so rightfully belongs to the First World. Haiti, for example, is under a capitalist regime. Now, these "communists" that the CIA went after were not helped in any appreciable way by the Kremlin, because the last thing the Kremlin bosses wanted was a successful Leninist revolution that would show them up as the frauds that they were. But these "communists" were not economic liberals either. Many may have been anarchists, but the majority were probably misguided Stalinists or reform-minded (not revolutionary-minded) social democrats of one stripe or another. Some few may have been genuine Leninists, but all were patriotic nationalists. Certainly the comprador middle-classes of these countries don't want their privileges taken away in any real proletarian social revolution. If you look at any reports of death-squad activity in Latin America, you'll find the CIA involved and you'll also find that their attacks are on union organizers who have ties to one or another Marxist political party. Now, if you peel the onion back a little, you'll see who globally are the real archenemies of the capitalist ruling classes that the CIA, MI-6, French Intelligence, the Mossad, the World Anti-Communist League, ad nauseam, are doing their dirty work for. If you take this a little further, you'll realize that there are well-funded organizations in the United States that keep the American workers and small farmers tied through billions of propaganda dollars to collusion with this global control of the world's labor markets to keep profits up by keeping labor in the so-called "Third World" cheap -- making Americans collaborators with global fascism or at least blinding them to it. Actually, the word "fascism" describes a more specific political dynamic, but I'll fudge a little here. I like your phrase "Nazi Kleptocracy": seems to fit the Global elite to a tee when you consider that the CIA and its sister organizations were products of the Anglo-American pact with late 20th-century Nazi Germany (the so-called Bundesrepublik) following the demise of Hitler. If all this sounds like Red propaganda, you should know that it's coming from someone who grew up a staunch anti-communist and even had trouble trying to learn Russian (linguistics is my main interest) because it stuck in the craw for the "evil commie language" I was constantly told it was as a young person.
Vlady, with all due respect (and you know how much respect I believe you warrant), this does not sound so much like red propaganda, but moving the discourse to sub-elite finger pointing dialectic. Perhaps there will be a time when all freedom loving people can engage in the dialectic so that freedom and liberty is the underlying principal and debates are directed toward which way is better at attaining that freedom and liberty. Now it seems that the MSM holds the principal that feudalism and monarchies are necessary and debates are limited to which feudalist system (like Nazi Germany v. Stalinist Russia) is preferable. So to take a step back, what shocked me the most about Jay's apparent exposure as being a psycopathic dictator is that he is at the top of the food chan. The three headed beast of Rothschild/Rockefeller/Beatrix is now exposing its true intentions and I believe that this is very important. The discussions of a puppet dictator being under capitalist rule or communist rule seems to be a little less important to me considering that there is no truly capitalist or communist state. We have faux capitalist and faux communist matrices of deception. The battle IMO is local governance and power over centralized, dictatorial, totalitarian rule. I believe that local communes should be allowed and not considered an enemy of the state and I also believe that manufacturers should be able to build products without the invasion of WTO, NAFTA, etc. But on the contrary, I believe that communes who engage in stuff like institutionalized torture or rape should be brought to justice and I feel that manufacturers who pollute other people's land/air/sea should be brought to justice. I think that the US constitution allows the freedoms of local communities to create whatever local social construct they wish. And I believe that Jay Rockefeller wants only one social construct-a theosophical social construct where the elites control all. I believe that his desire to control the Internet is another piece of evidence furthering my thesis. By exposing these psycopathic madmen and their true intentions, their power fades. This power to deceive has stopped many US local communities from cutting through the matrix and engaging in self-governance. I believe that by tearing down the curtains many "third world" countries would also have a greater chance of deciding their own social rule.
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
HeismaN
|
 |
« Reply #203 on: March 22, 2009, 04:27:14 PM » |
|
This thread was just mentioned on the Radio show
|
|
|
|
|
Logged
|
|
|
|
|
lordssyndicate
|
 |
« Reply #204 on: March 22, 2009, 04:36:10 PM » |
|
As I realized this morning they don't need a massive attack of any larger proportions than the one they already staged on Marine One...
To the average sheeople this is a pearl harbor...... After all "Iranians got the plans to Marine One... because .... of .. the ... internet...." It occurred to me to take my own advice and try to think differently on this subject. So, while they will continue to have the capability to wage false flag terror on Inet2 it will be controlled completely by them and they will no longer have an alternative media. This is the key Ineternet 2 comes first false flag second because if we can defend ourselves they know they will loose...
And So this friday Jay blatantly declares war on the internet- hence sane started this thread ....
I will post a transcript of my call later when it comes out on podcast.....
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
lordssyndicate
|
 |
« Reply #205 on: March 22, 2009, 05:03:24 PM » |
|
Meaning - to us the alternative media - the fight is on -Jay! ... Every one please tell your congress man to oppose net neutrality and the push toward internet 2 ..... Let every one you know about why internet 2 will be bad... The article knowledgebase is all here in the forum ... (I will add more links when I have more time ...)
We must stop them now before they silence us.
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
Dig
|
 |
« Reply #206 on: March 22, 2009, 05:51:06 PM » |
|
I am posting this alert because I believe it is important. I have been getting reports that the original video from CSPAN has been down or does not include the last 45 minutes. I advise people to download it locally, record it (yes the whole fricking thing) and post it to youtube in segments if necessary.
I still cannot believe everything revealed by Jay's statements. I think he thought he was in a closed session or something because it did not seem to be his regular type of conversation.
So please see if you can high res it to youtube or even torrent. I am still uncovering more information from the transcript and would like to be able to point to youtube for people to see it themselves seeing as the cspan method is hit or miss.
thanks
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
DireWolf
|
 |
« Reply #207 on: March 22, 2009, 06:25:13 PM » |
|
Even if it includes thousands of targets? WTF? Hitler didn't have balls big enough to openly declare everyone a suspect.
|
|
|
|
|
Logged
|
Freedom and Liberty, or slavery and death, your choice, choose wisely.
|
|
|
|
|
|
DireWolf
|
 |
« Reply #209 on: March 22, 2009, 07:08:43 PM » |
|
I agree with you 100% I forget the masses watch TV more than any other activity that they participate in, thanks for jogging my memory.
|
|
|
|
|
Logged
|
Freedom and Liberty, or slavery and death, your choice, choose wisely.
|
|
|
|
Dig
|
 |
« Reply #210 on: March 22, 2009, 09:18:46 PM » |
|
A bill to shift cybersecurity to White House by Stephanie Condon http://news.cnet.com/8301-13578_3-10200710-38.htmlForthcoming legislation would wrest cybersecurity responsibilities from the U.S. Department of Homeland Security and transfer them to the White House, a proposed move that likely will draw objections from industry groups and some conservatives. CNET News has obtained a summary of a proposal from Senators Jay Rockefeller (D-W.V.) and Olympia Snowe (R-Maine) that would create an Office of the National Cybersecurity Advisor, part of the Executive Office of the President. That office would receive the power to disconnect, if it believes they're at risk of a cyberattack, "critical" computer networks from the Internet. "I regard this as a profoundly and deeply troubling problem to which we are not paying much attention," Rockefeller said a hearing this week, referring to cybersecurity. Giving the White House cybersecurity responsibility was one of the top recommendations of a commission that produced a report last year to advise President Obama on cybersecurity issues. However, the Homeland Security Department, which currently has jurisdiction over cybersecurity, has insisted the reshuffling of duties is not needed. Given the enormity of cybersecurity threats, the responsibility is a natural fit for the White House, said James Lewis, a director and senior fellow at the Center for Strategic and International Studies, which issued last year's commission report. "The Obama administration has an adviser on energy and climate change, and that's good and important," Lewis said, "but we're still in the mode that cyber is less important." While the bill is still in draft form and thereby subject to change, it would put the White House National Cybersecurity Advisor in charge of coordinating cyber efforts within the intelligence community and within civilian agencies, as well as coordinating the public sector's cooperation with the private sector. The adviser would have the authority to disconnect from the Internet any federal infrastructure networks--or other networks deemed to be "critical"--if found to be at risk of a cyberattack. The private sector will certainly speak out if this provision is included in the final draft of the bill, a representative of the technology industry who spoke on condition of anonymity said. "You can be assured that if that idea is put into legislation we would certainly have views on it," he said. "It's not trivial." While the person did not take a stance on whether the White House is the appropriate place to put cybersecurity jurisdiction, he said, "cybersecurity is a cross-cutting issue, across all government agencies, so leadership at the top is useful." The bill could also make the proposed cyber adviser responsible for conducting a quadrennial review of the country's cybersecurity program, as well as for working with the State Department to develop international standards for improving cybersecurity. The draft version of the bill also establishes a clearinghouse for the public and private sectors to share information about cyberthreats and vulnerabilities. It also creates a Cybersecurity Advisory Panel consisting of outside experts from industry, academia, and nonprofit groups to advise the president. Because many federal contracting officers do not currently include security provisions into federal procurements, the bill could also establish a "Secure Products and Services Acquisitions Board" to review and approve all federal acquisitions. At Thursday's hearing, Edward Amoroso, AT&T's senior vice president and chief security officer, said the federal procurement process "needs to be upgraded to implement sufficient security protections." Some industry groups are warning, however, that adding customized requirements to the government's procurement process may inhibit the government's ability to take advantage of the innovations and cost benefits available from commercial technology. "Simply put, the government cannot reach its security goals by compromising its access to commercial solutions and processes, nor can it technologically or financially afford it," the Business Software Alliance wrote in a memo to Melissa Hathaway, the acting senior director for cyberspace at the White House National and Homeland Security Councils, who is conducting a 60-day review of cybersecurity programs for President Obama. "Rather than imposing overbroad security requirements, government needs to be selective and limit them to high-criticality systems." The bill may also subject both government and private sector networks to cybersecurity standards established by the National Institute of Standards and Technology. It may also provide for a professional licensing and certification program for cybersecurity professionals. The senators also want to create greater general awareness of the importance of cybersecurity, so the legislation would expand scholarships for students studying cybersecurity, create an annual cybersecurity competition and prize for students, and initiate a cybersecurity awareness campaign. It would also increase cybersecurity research and development funding for the National Science Foundation. Lewis said he is very pleased with the Senate's work on this bill so far. "Having a knowledgeable and powerful group of senators that are willing to pick up the ball and run with it is really encouraging," he said. Given the broad nature of the legislation--which spans intelligence and homeland security issues, as well as commerce issues--Rockefeller may have to work with the leaders of the Senate Homeland Security Committee and other leaders in the Senate to shape the final version. An industry representative said, though, that Rockefeller's previous experience chairing the Select Committee on Intelligence will improve the bill's chances of advancing. "His personal credibility and experience allow him to play a role that another chairman might necessarily have been able to play," the industry representative said. ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Jay is really stepping out of the shadows for this one.
He does not trust the morons at Homeland Insecurity to handle his upcomming false flag cyber/bird flu attack.
Hey Jay...
EVERYBODY KNOWS THAT YOU ARE BEHIND THE UPCOMMING CYBER ATTACK
YOU MEET WITH BOOZ ALLEN HAMILTON, MITRE, AND PTECH ASSHATS TO SHIT DOWN THE INTENET
STOP NUKING THE NET!
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
vladimir
Guest
|
 |
« Reply #211 on: March 22, 2009, 09:36:42 PM » |
|
Vlady, with all due respect (and you know how much respect I believe you warrant), this does not sound so much like red propaganda, but moving the discourse to sub-elite finger pointing dialectic. Perhaps there will be a time when all freedom loving people can engage in the dialectic so that freedom and liberty is the underlying principal and debates are directed toward which way is better at attaining that freedom and liberty. Now it seems that the MSM holds the principal that feudalism and monarchies are necessary and debates are limited to which feudalist system (like Nazi Germany v. Stalinist Russia) is preferable.
So to take a step back, what shocked me the most about Jay's apparent exposure as being a psycopathic dictator is that he is at the top of the food chan. The three headed beast of Rothschild/Rockefeller/Beatrix is now exposing its true intentions and I believe that this is very important. The discussions of a puppet dictator being under capitalist rule or communist rule seems to be a little less important to me considering that there is no truly capitalist or communist state. We have faux capitalist and faux communist matrices of deception. The battle IMO is local governance and power over centralized, dictatorial, totalitarian rule. I believe that local communes should be allowed and not considered an enemy of the state and I also believe that manufacturers should be able to build products without the invasion of WTO, NAFTA, etc. But on the contrary, I believe that communes who engage in stuff like institutionalized torture or rape should be brought to justice and I feel that manufacturers who pollute other people's land/air/sea should be brought to justice.
I think that the US constitution allows the freedoms of local communities to create whatever local social construct they wish. And I believe that Jay Rockefeller wants only one social construct-a theosophical social construct where the elites control all. I believe that his desire to control the Internet is another piece of evidence furthering my thesis.
By exposing these psycopathic madmen and their true intentions, their power fades. This power to deceive has stopped many US local communities from cutting through the matrix and engaging in self-governance. I believe that by tearing down the curtains many "third world" countries would also have a greater chance of deciding their own social rule.
Sane, I can't find anything you said that I disagree with. And the dialectic is key. Couldn't agree more! Not the totalitarian version of Hegel, of course. A famous American translator of Hegel, who's name I forget, said that the Battle of Stalingrad was a face-off between the forces of Right Hegelianism and Left Hegelianism. Left Hegelianism was the path of Ernst Renan ( The Life of Jesus), Ludwig Feuerbach ("love is the deciding force in the world"), and Karl Marx. Right Hegelianism was pushed in American universities following the (semi-secret) post-1945 pact with German Nazism (and founding of the Bundesrepublik as a bastion of anti-communism). A friend of mine studying (Right Hegelian) Martin Heidegger as a representative of Existentialism showed me one of Heidegger's Hitler-era letters which bore Heidegger's close "Heil Hitler!". Looking to check just now whether I had Heidegger's name spelled right, I found out that Heidegger had an extra-marital affair with Hannah Arendt (at least that was a claim I saw in a URL blurb). A Maoist friend of mine in the anti-war movement criticized me once for using the word "totalitarianism", saying the term was coined by Hannah Arendt. This is not true (and Maoists are often beset by untruth, although their proletarian impulses are often genuine) because Leon Trotsky used the word "totalitarianism" in an essay late in his life to characterize the "Soviet" Union under Stalin. This man Trotsky has been the special target of nazi-inspired rhetoric from the American Far Right because their puppet masters realize that he embodied the genuine revolutionary heritage of Marx and Lenin (at least in Lenin's early days of leadership in the Russian party). You may know that Lenin, Trotsky, and the Left Opposition in the Russian Bolshevik Party fought Stalin and his faction on the question of forced collectivization. Collectivization was to be introduced on the Swedish model by establishing model farms to show small farmers the benefits of pooling their resources. It was to be spread by example. Marx would have railed against forced collectivization and any other such act of totalitarianism (even in the midst of a civil war and foreign invasion). Marx has to be read to understand what he meant by seemingly authoritarian phrases such as "dictatorship of the proletariat". Read in context and in the spirit of what he was trying to say (and, if read without prejudice, he did make it clear) he comes across as a defender of the individual and an opponent of tyranny. He has gained little sympathy in the U.S., however, due to the promotion of laissez-faire capitalism here as an article of faith and the promulgation of endless "critiques" which misrepresent his positions -- usually by well-paid university professors.
|
|
|
|
|
Logged
|
|
|
|
|
|
|
Mike Philbin
Guest
|
 |
« Reply #213 on: March 23, 2009, 01:56:09 AM » |
|
go NEW ZEALAND (!) educate your people
|
|
|
|
|
Logged
|
|
|
|
|
|
|
Dig
|
 |
« Reply #215 on: March 23, 2009, 07:51:36 AM » |
|
From the PP Forum graphic artist Brocke.... 
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
Dig
|
 |
« Reply #216 on: March 23, 2009, 07:53:47 AM » |
|
Another prize winning graphic from Brocke: 
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
Mike Philbin
Guest
|
 |
« Reply #217 on: March 23, 2009, 08:10:07 AM » |
|
We wouldn't have seen it without people like you uploading stuff like this. Congrats to all.
|
|
|
|
|
Logged
|
|
|
|
|
uwaf
|
 |
« Reply #218 on: March 23, 2009, 09:34:00 AM » |
|
They will use, the Porn card to the sheople as to why we have to clean up the net ie take it down and put up what WE want. And they'll use the, they can make bombs and organize on the net.
|
|
|
|
|
Logged
|
|
|
|
|
Anti_Illuminati
Guest
|
 |
« Reply #219 on: March 23, 2009, 03:11:41 PM » |
|
From the PP Forum graphic artist Brocke....  HAHAHAHAHAHAHA!!!! I LOVE IT!
|
|
|
|
|
Logged
|
|
|
|
|
lordssyndicate
|
 |
« Reply #220 on: March 23, 2009, 05:08:41 PM » |
|
Agreed Anti - that is Awesome. Thanks for posting Sane.  Thanks Brocke for creating it. and thanks to Dave for posting the you tube. Here http://www.badongo.com/audio/14030115is a link to my call on AJ on this past sunday..... I will post the transcript as soon as it's done... I'm still lagging behind on that I know ...
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
KiwiClare
|
 |
« Reply #221 on: March 23, 2009, 11:42:41 PM » |
|
Thank-you Brocke! Your artwork is revolutionist. I have been using it a lot in the last few weeks to add that extra special something to posts.  Keep it coming please. It is very much appreciated.
|
|
|
|
|
Logged
|
To be persuasive, we must be believable, To be believable, we must be credible, To be credible, we must be truthful. - Edward R. Murrow
|
|
|
|
lordssyndicate
|
 |
« Reply #222 on: March 24, 2009, 05:50:09 AM » |
|
Sorry to take so long with getting this out.
I was a bit tied up with some personal issues yesterday....
Transcript from 1 hour and 14 minutes in on Sunday, March 23rd , 2009's Alex Jones Show on KLBJ.
~~~~~~~~~Begin Transcript~~~~~~~~~~~~ ....... AJ: Josh In NC
Me: Uhh, Yes, Hello Alex. So what I want to try and bring to people’s attention today – is umnn a post that Sane put up on Friday on the forum. But umnnn , what he highlights is .... just go to YouTube. Rockefeller - basically Jay declared war on the internet. The exact headline ... umnn... Hang on let me grab it.
AJ: Yeah, I was listening to BBC radio on XM today - driving into the office today. ..And they.. Open...They had the inventor of the internet –on there admitting - a British scientist - that they are already shutting down the original web. Total censorship coming in now, because they are taking over through banking fraud they can’t have us on the web.
Me: (Distortion over the word– Right)..Exactly and the exact headline at google is “ Jay Rockefeller Internet should have never existed . If you go to YouTube right now and plug that in that should pull it up. And this him basically saying their going to pull the plug on it very soon. And that thread itself has a lot of evidence showing that they’re gearing up so that basically ..umnn . you know ... At this point they’ve had kinda their false flag with Marine One
AJ: Yeah claim hackers got the data. Stay there I’m going to put you on hold. Come back to all of your calls after this quick break. I’m Alex Jones – Inforwars.com while you can still visit it and prisonplanet.com. See the Obama Deception online for free. It’s free everywhere just Google the Obama Deception
<Commercial Break>
AJ: Oh Yeah We found the you tube clip of in a senate hearing of senator Jay Rockefeller saying “ hey the Russians the Chinese some kid in another country can attacks us from the internet we got to shut it down. As the New York Times said 2 weeks ago “ A new Safer Internet. Internet 2 where you won’t have any free speech and there will be a few thousand choices of corporate news and information. They’re moving we’re kicking their hind end in now. Good luck in shutting the web down boys. Go ahead and try. That is coming up a bit later.
AJ: Let’s, who was I talking to just now..? Caller wise? I’ve forgotten the name of who I was directly going too. Ok Josh. I’m talking to Josh in NC. Ok Josh, finish up your points.
Me: Hey yes again Alex great to be back with you. I was the one of course bringing to your attention that rockefe coming out on fri and formally announcing that wish to end the web well the net in general. So basically there’s a thread on the prison planet forum discussing this , there is a a lot of evidence that they are gearing toward this...... . Alex: ....No - they admit Internet2, taxing the web, ending net neutrality, the headlines in Australia , Chinese style internet censorship . They’re doing it ...... They’re doing it..... Me: Yup, their doing it as we speak. And that is the thing Their doing IT NOW. This is happening now. We’re moving to Internet2 and ... as I’m.... ya know ... as I point out on the forum here -ya know - people are in the matrix....you don’t...... The average Joe doesn’t care about....ya know ... how the internet works it’s like is his TV.
AJ: And the elite Don’t care about him....and...
Me: ..Exactly.....
AJ: And ... And that’s the amazing issue. Thanks for the heads up. I’ll tell ya, our listeners give us all these heads up. .....
~~~~End Transcript~~~~~~~
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
Anti_Illuminati
Guest
|
 |
« Reply #223 on: March 24, 2009, 06:16:21 AM » |
|
YOU CANNOT MAKE THIS STUFF UP!!!http://www.mitre.org/news/digest/advanced_research/02_09/genes.html(See above link for a pic of a bunch of scumbags who work for the NWO, not gonna bother posting it here until it gets appropriately photoshopped 1st.) Hunting Dangerous Genes, Inbox by InboxFebruary 2009 The building blocks for deadly bio-weapons are available by email or online to almost anyone who cares to place an order—and the world has begun to pay attention. "Current government oversight of the DNA-synthesis industry falls short of addressing this unfortunate reality," wrote a group of academics, industry executives, and security experts in a 2007 article, "DNA Synthesis and Biological Security," which appeared in the journal Nature Biotechnology. Addressing that scary scenario head-on is a group of MITRE experimental and computational biologists developing a method for weeding out dangerous synthetic DNA orders from harmless ones. They call their fledgling process DOTS, short for DNA Order Tracking System. And with the success of an early prototype, they now have set their sights on making DOTS available outside of the laboratory. Some background: Genetic materials made to order from the basic chemical components of DNA are now routinely manufactured by dozens of companies in the United States and abroad. Anyone can place an email order with these DNA synthesis companies for any combination of genetic base pairs A, T, G, and C and have the order delivered. (Please see "The ABCs of ATGC," on this page.) It's also cheap: costs for DNA synthesis have fallen from $30 per base pair in 1990 to roughly 55 cents per base pair today. So far, one factor limiting easy abuse of factory-made genetic materials is that no manufacturer has yet been able to make a DNA sequence longer than 35,000 base pairs. Because a virus like Variola major, which causes smallpox, contains 190,000 base pairs of DNA, some feel comfortable that would-be bioterrorists can't readily order such dangerous pathogens. "Don't be so comfortable," warns John Dileo, experimental biologist and MITRE's lead in the DOTS project. "Small lengths of DNA can be ordered from multiple manufacturers and then stitched together" to make a potentially deadly virus.MIT's Drew Endy, a leading authority on synthetically engineered pathogens, offered a simpler "genetic hack" to the audience at the 24th Chaos Congress in Berlin in 2007: "You can add key genes to an otherwise harmless but close relative to the virus" and thereby convert it to a virulent pathogen. Dileo, citing a sobering example, reckons that the ultra-deadly genome of the Ebola virus, which is fewer than 19,000 base pairs, would cost a mere $8,500 to manufacture. Siloed Checks Provide No Safeguard In 2005, researchers at the U.S. Centers for Disease Control and Prevention (CDC) in Atlanta, Ga., showed just how easy this process can be. They placed email orders to purchase many different DNA sequences from several manufacturers and then stitched those sequences together, thereby recreating the virus that caused the 1918 flu pandemic that killed 40 million people worldwide. Thankfully, these were the good guys—but what if they weren't?James Diggans, Dileo's colleague and DOTS co-developer, cites published reports showing that virtually all DNA synthesizers have some kind of screening system in place to "systematically check their orders and ensure that they are not constructing and delivering dangerous DNA sequences." These screening systems, however, are designed to detect orders for large segments (more than 300 base pairs) of DNA from a single vendor. A bad actor ordering smaller segments from multiple vendors for later assembly into an infectious agent would go unnoticed, and it is this shortcoming that the DOTS system addresses. Though a new industry, DNA synthesis is a burgeoning one. In the U.S. alone, manufacturing requests are on track to top more than 15 million orders a month by 2012, up from 9 million a month just two years ago. Overwhelmingly, the orders are from trusted government, private, and university laboratories that use the synthetic DNA for legitimate research. However, it's an order stream that is not monitored across companies in an industry that's essentially unregulated. As such, the potential for danger by those committed to the covert production of biological weapons remains unaddressed.A recent survey conducted by the publication New Scientist found wide divergence in industry reaction to overseeing questionable DNA orders. "It's not our job," reported the director of Genemed Synthesis in California. The general manager at Bio Basic in Canada admitted only to spot-checking orders. Conversely, the president of Blue Heron in Bothell, Wash., claims that his company checks every order. And Picoscript of Houston, TX, turned down an email order from a reputable U.S. laboratory when it learned that the order was to be shipped to an unknown third party in a foreign country. For Dileo and Diggans, the lack of uniformity and siloed nature of these companies' policies is insufficient to address the threat posed by the technology. Developing a Hard-to-Evade System For three years now, DNA synthesizers' only defense against such orders—other than scrutinizing their own in-boxes—has been freely available software from a West Coast software development company. According to the developer, the software is "designed to identify DNA and protein sequences derived from hazardous biological agents," tracking potential problems by uploading the ordered sequence and matching them against select agents in the National Institutes of Health's GenBank genetic sequence database. However, "the software can be evaded by breaking select agent sequences into short segments and ordering from a number of synthesis companies allowing intent to fly under the radar," contends MITRE's David Walburger, another of the DOTS researchers. That's where DOTS comes into play, say Dileo and Diggans. They recently co-presented their new order-checking software at a MITRE Lecture Series event on bio-security. They reported that DOTS scrutinizes DNA sequences from both the black list as well as a "grey list," made up of DNA sequences that could be either virulent or harmless depending on how they are used. The system also checks the additional details found in every order, such as buyer information, shipping, and other relevant data. This information becomes the input for specially designed algorithms to calculate a threat score for any one order or collection of orders. DOTS processes and re-processes the orders in the database looking for collections of DNA strings that, if stitched together, could be hazardous. To date, the DOTS prototype can efficiently process 10,000 orders at a time on a single processor, with each screened order ranging from 20 to 300 base pairs in length. Of course, checking 10,000 orders is a far cry from the 15 million orders a month worldwide expected by 2012. The goal now is to scale up DOTS and move to a computing cluster to meet that demand. "Based on past experience," notes Dileo, "within the next two or three years some federal agency will be given a national security mandate to be responsible for monitoring and regulating recombinant and synthetic DNA activities." Well in advance of that looming directive, the MITRE DOTS team feels confident that their DNA Order Tracking System will be ready for use by government and industry partners. The ABCs of ATGC
The English alphabet's 26 letters can combine to form enormous numbers of meaningful expressions. "I am brewer's yeast" uses 15 letters and an apostrophe. Similarly, DNA has an alphabet, but one consisting only of four letters: A,T,G, and C. Using these four letters, DNA can spell out the genetic sequence for any living organism or any parts thereof.
Below is the bare beginning of the DNA's spelling for brewer's yeast. When finished, the sequence will contain nearly 13 million distinct letters all from the DNA alphabet.
AACAAGATGCCATTGTCCCCCGGCCTCCTGCTG CTGCTGCTCTCCGGGGCCACGGCCACCGCTGCC CTGCCCCTGGAGGGTGGCCCCACCGGCCGAGAC AGCGAGCATATGCAGGAAGCGGCAGGAATAAGG AAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGG TTTGAGTGGACCTCCCAGGCCAGTGCCGGG...
Each letter in the DNA alphabet represents four distinct chemical substances called nucleotide bases. The letter A stands for the chemical base adenosine, while C is for cytosine; G is for guanine; and T is for thymine. These sequences of DNA bases are used to make up genetic factory orders; instructions that the body’s ribosomes will then follow to manufacture the necessary proteins that maintain all biological functions.
The key to modern genetics is "sequencing" those bases: figuring out the makeup of each gene by splitting the gene into multiple fragments in order to determine the exact order of the nucleotides. Once a gene's ATGC sequence has been revealed, it's then possible to manufacture those gene sequences artificially in a laboratory. And since 2005, a gene "synthesizing" industry that manufactures complete gene sequences as well as shorter lengths of DNA for a variety of applications has sprung up worldwide to do just that.
While naturally occurring genetic structures remain the research province of microbiologists and geneticists, separating and recombining "synthesized" DNA into new or novel genetic structures is the domain of synthetic biologists. Hence, it was synthetic biology that recreated the deadly 1918 flu virus from snippets of base pairs. Similarly, synthetic biology is at the root of the experimental drug MT103, a vaccine engineered via computer simulation that convinces the body's immune system to hunt down and destroy cancer cells. And synthetic biologists may well be the ones who ultimately manipulate DNA sequences and living systems into workarounds for—or total elimination of—many of the more than 4,000 inherited genetic diseases that plague human health.
|
|
|
|
|
Logged
|
|
|
|
Geolibertarian
Global Moderator
Member
   
Offline
Posts: 9,862
9/11 WAS AN INSIDE JOB! www.ae911truth.org
|
 |
« Reply #224 on: March 24, 2009, 08:53:09 AM » |
|
Now you know why I link to "election reform" in my signature, because we'll never be able to reassert our rightful control over government as long as we have rigged elections; and as long as our government remains under the control of a group of treasonous, psycophatic, America-hating control-freaks, they'll continue getting away with the crimes and terrorist activities they incessantly engage in. These parasites belong in prison, it's as simple as that.
|
|
|
|
|
Logged
|
|
|
|
|
JBS
Guest
|
 |
« Reply #225 on: March 25, 2009, 07:48:25 PM » |
|
I said it before and I'll say it again:
EAT ME JAY ROCKEFELLER! If you take away my keyboard, I might have to leave my virtual world and annoy you.
Sorry, I had to say it.
|
|
|
|
|
Logged
|
|
|
|
|
Dig
|
 |
« Reply #226 on: March 25, 2009, 07:55:43 PM » |
|
From YouTube...
Jay Rockefeller: Internet should have never existed Listen to it yourself. Captured from Cspan. Credit goes to the Prisonplanet community who found this. ... 5 days ago 36,284 views
bwaaaahaaaa
there are like 10 other people who also posted this.
I still have not seen one other "grass roots" blog talk about this shit.
Not "MediaMatters", "DailyKos", "Hotair", "Crooksandliars", "RawStory", "ThinkProgress", "Politico", "GlennBeck", "Hannity", "GregPalast", etc.
What part of "I do not think the Internet should ever have been created" do they not understand?
That is the co-dictator of the USA saying this, not Bill O'Reilly. I guess if Bill O said it at least Olbermann would talk about it.
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
Dig
|
 |
« Reply #227 on: March 25, 2009, 07:58:00 PM » |
|
YESSSSSSSSSSSSSSSSSSSSSSSSSSS!!!!! According to the great-grandson of John D. Rockefeller, nephew of banker David Rockefeller, and former Senate Intelligence Committee Chairman Jay Rockefeller the internet represents a serious threat to national security. Rockefeller is not alone in this assessment. His belief that the internet is the “number one national hazard” to national security is shared by the former Director of National Intelligence Mike McConnell and Obama’s current director Admiral Dennis C. Blair. “It really almost makes you ask the question would it have been better if we had never invented the internet,” Rockefeller mused during the confirmation hearing of Gary Locke (see video: http://www.youtube.com/watch?v=i8PCmLPPVnA ), Obama’s choice for Commerce Secretary. He then cites a dubious figure of three million cyber “attacks” launched against the Department of Defense every day. “Everybody is attacked, anybody can do it. People say, well it’s China and Russia, but there could be some kid in Latvia doing the same thing.” Jay Rockefeller’s comments reveal an astounding degree of ignorance – or if not ignorance, outright propaganda. Since the September 11, 2001, attacks the government has cranked up the fear quotient in regard to cyber attacks and so-called cyber terrorism, a virtually non-existent threat except in the minds security experts and politicians. In the years since the attacks, not one real instance of real cyberterrorism has been recorded. “Cyberattacks on critical components of the national infrastructure are not uncommon, but they have not been conducted by terrorists and have not sought to inflict the kind of damage that would qualify as cyberterrorism,” writes Gabriel Weimann, author of Terror on the Internet. “Nuclear weapons and other sensitive military systems, as well as the computer systems of the CIA and FBI, are ‘air-gapped,’ making them inaccessible to outside hackers. Systems in the private sector tend to be less well protected, but they are far from defenseless, and nightmarish tales of their vulnerability tend to be largely apocryphal.” “Psychological, political, and economic forces have combined to promote the fear of cyberterrorism,” Weimann continues. “From a psychological perspective, two of the greatest fears of modern time are combined in the term ‘cyberterrorism.’ The fear of random, violent victimization blends well with the distrust and outright fear of computer technology.” “The sky is not falling, and cyber-weapons seem to be of limited value in attacking national power or intimidating citizens,” notes James Lewis of the Center for Strategic and International Studies. Such a threat is overblown, Lewis explains. He notes that “a brief review suggests that while many computer networks remain very vulnerable to attack, few critical infrastructures are equally vulnerable.” In other words, Rockefeller’s example of a kid in Latvia with a laptop posing a serious “hazard” to national security is little more than sensationalistic propaganda. So-called cyber terrorists are far less of a threat than government. China and Australia have recently imposed draconian censorship on internet freedom. Brazil, Denmark, Canada, Finland, Ireland , Italy, Israel, the United Kingdom, the United States, and many other countries also impose nominal censorship on internet freedom. Urgent calls to restrict the medium in various ways through legislation and government action have increased over the last few years (for more detail, see Internet Censorship: A Comparative Study). However, the real threat to internet freedom is currently posed by IT and ISP corporations, not the government. As Alex Jones explained last June, large corporate ISPs are now in the process of imposing bandwidth caps and routing traffic over their networks and blocking certain targeted websites. For instance, in 2005 AOL Time-Warner was caught blocking access to all of Jones’ flagship websites across the entire United States. Other instances of outright censorship include the UK ISP Tiscali blocking subscribers from reaching material on the 7/7 London bombings and Google’s continued and habitual censorship of 9/11 material and Alex Jones’ films on the ever-popular YouTube. There are many other instances as well. (See Censoring the Internet: A Collection of Essential Links on Infowars.) Jay Rockefeller’s warning about virtually non-existent and largely absurd cyberterrorism reveals increasing government nervousness and apprehension about the medium as a whole, especially as the internet grows by leaps and bounds as an alternative news and activism medium. On numerous occasions over the last few years alternative websites have posted articles exposing government crime, articles the corporate media has largely ignored. During the Bush years, the internet served as a vital resource for information on everything from torture and the destruction of civil liberties to the invasions and occupations of Iraq and Afghanistan, information the corporate media was often unable or unwilling to carry. For instance, earlier this month Infowars broke a story concerning the Missouri Information Analysis Center and its effort to profile Libertarians and Ron Paul supporters as terrorists. The story was subsequently picked up by the corporate media (although Alex Jones and Infowars did not receive attribution). As more corporate media outlets fail — as evinced by several high profile newspapers going out of business recently — and more people flock to the internet to get their news and information, the government will increasingly employ fear tactics designed to portray the medium as a refuge for terrorists, pedophiles, and other miscreants. It appears the Obama administration is attempting to micromanage this effort. Last week CNet “obtained a summary of a proposal from Senators Jay Rockefeller (D-W.V.) and Olympia Snowe (R-Maine) that would create an Office of the National Cybersecurity Advisor, part of the Executive Office of the President. That office would receive the power to disconnect, if it believes they’re at risk of a cyberattack, ‘critical’ computer networks from the Internet.” As well, the effort would put the White House National Cybersecurity Advisor in charge of coordinating cyber efforts within the intelligence community and within civilian agencies.
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
Elvis
|
 |
« Reply #228 on: March 25, 2009, 09:16:04 PM » |
|
While we're on the subject of Elites, have you ever noticed how far apart and small some of their eyes are? David Rockefeller Joan Rothchild Marine Iguana I'm not sayin', I'm just sayin' ...
|
|
|
|
|
Logged
|
"A great civilization is not conquered from without until it has destroyed itself from within." - Will Durant
|
|
|
|
thought_criminal
|
 |
« Reply #229 on: March 25, 2009, 09:28:50 PM » |
|
Hehe. Inbreed old money power trippers.
The elites who espouse and work toward world government are "the #1 cause of attacks, and should not exist"
The internet is the "free press" our founding fathers spoke of. In populated areas, Draft-N WiFi set up as "Ad Hock" can still allow a form of localized P2P net even if internet is shut down. If WWW2 allows emails/VPN then you can still work around censorship, by connecting local p2p nets to a larger "underground internet" with Onion routing, etc. etc.
"Shutting down the internet" won't apply to those who have the right software / knowledge. It'll simply contain "viral" information from hitting the masses and waking up new people.
I've been trying to hammer out (mental blueprint at this stage) a piece of software that'll allow people to still communicate censor free after the www backbone servers are taken offline. So long as www2 still allows *communication* at all, then you can covertly still communicate censor free.
I really hope it doesn't come to that. We shouldn't have to hide in the shadows like some Orwellian dystopia.
But if it comes to that... It'd be good to have a means of still staying connected. . . Like the "fax brigades" behind the iron curtain.
|
|
|
|
|
Logged
|
"It is the first responsibility of every citizen to Question Authority." - Benjamin Franklin
|
|
|
|
Dig
|
 |
« Reply #230 on: March 25, 2009, 09:31:48 PM » |
|
They are running the whole thing again on CSPAN 3 RIGHT NOW!!! http://c-span.org and listen or view cspan3!
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
|
|
hyperqube
|
 |
« Reply #232 on: March 25, 2009, 09:56:16 PM » |
|
While we're on the subject of Elites, have you ever noticed how far apart and small some of their eyes are? lol, no shit that's because.....
|
|
|
|
|
Logged
|
|
|
|
|
lordssyndicate
|
 |
« Reply #233 on: March 25, 2009, 09:56:48 PM » |
|
He's saying that shit right now.. The "any one can do it"... part of the speech right now... Grrr ...
"Nobel Loriets of NIST ..." meaning death bringers / executioners of the internet as we know it.
Flase flag setup from hell .,..
grr .. This pisses me off every time I hear it.
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
Dig
|
 |
« Reply #234 on: March 25, 2009, 09:59:02 PM » |
|
here it is...
"individual act, not a sleeper cell can bring this country down. Bring down the electrical system, the banking system..."
one person anywhere can bring the entire country down...
JAY IS TOTALLY INSANE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
SOMEBODY GET HIM TO AN MK ULTRA PSYCH WARD ASAP!
|
|
|
|
|
Logged
|
All eyes are opened, or opening, to the rights of man. The general spread of the light of science has already laid open to every view the palpable truth, that the mass of mankind has not been born with saddles on their backs, nor a favored few booted and spurred, ready to ride them legitimately
|
|
|
|
lordssyndicate
|
 |
« Reply #235 on: March 25, 2009, 10:02:21 PM » |
|
here it is...
"individual act, not a sleeper cell can bring this country down. Bring down the electrical system, the banking system..."
one person anywhere can bring the entire country down...
JAY IS TOTALLY INSANE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
SOMEBODY GET HIM TO AN MK ULTRA PSYCH WARD ASAP!
Him and the sad masses of sheeople that are IT illiterate who believe him ... :/
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
lordssyndicate
|
 |
« Reply #236 on: March 25, 2009, 10:17:36 PM » |
|
The Senate has no reason to listen to NIST the write NIST policy while relying on DISA standards for all of their own security. DISA is set by the DOD . NIST is set by congress for civiilian use http://www.disa.mil/But to the average joe with no clue this sounds like a tradegy.
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
criticalunity
|
 |
« Reply #237 on: March 25, 2009, 10:32:31 PM » |
|
Sorry to take so long with getting this out.
I was a bit tied up with some personal issues yesterday....
Transcript from 1 hour and 14 minutes in on Sunday, March 23rd , 2009's Alex Jones Show on KLBJ.
~~~~~~~~~Begin Transcript~~~~~~~~~~~~ ....... AJ: Josh In NC
Me: Uhh, Yes, Hello Alex. So what I want to try and bring to people’s attention today – is umnn a post that Sane put up on Friday on the forum. But umnnn , what he highlights is .... just go to YouTube. Rockefeller - basically Jay declared war on the internet. The exact headline ... umnn... Hang on let me grab it.
AJ: Yeah, I was listening to BBC radio on XM today - driving into the office today. ..And they.. Open...They had the inventor of the internet –on there admitting - a British scientist - that they are already shutting down the original web. Total censorship coming in now, because they are taking over through banking fraud they can’t have us on the web.
Me: (Distortion over the word– Right)..Exactly and the exact headline at google is “ Jay Rockefeller Internet should have never existed . If you go to YouTube right now and plug that in that should pull it up. And this him basically saying their going to pull the plug on it very soon. And that thread itself has a lot of evidence showing that they’re gearing up so that basically ..umnn . you know ... At this point they’ve had kinda their false flag with Marine One
AJ: Yeah claim hackers got the data. Stay there I’m going to put you on hold. Come back to all of your calls after this quick break. I’m Alex Jones – Inforwars.com while you can still visit it and prisonplanet.com. See the Obama Deception online for free. It’s free everywhere just Google the Obama Deception
<Commercial Break>
AJ: Oh Yeah We found the you tube clip of in a senate hearing of senator Jay Rockefeller saying “ hey the Russians the Chinese some kid in another country can attacks us from the internet we got to shut it down. As the New York Times said 2 weeks ago “ A new Safer Internet. Internet 2 where you won’t have any free speech and there will be a few thousand choices of corporate news and information. They’re moving we’re kicking their hind end in now. Good luck in shutting the web down boys. Go ahead and try. That is coming up a bit later.
AJ: Let’s, who was I talking to just now..? Caller wise? I’ve forgotten the name of who I was directly going too. Ok Josh. I’m talking to Josh in NC. Ok Josh, finish up your points.
Me: Hey yes again Alex great to be back with you. I was the one of course bringing to your attention that rockefe coming out on fri and formally announcing that wish to end the web well the net in general. So basically there’s a thread on the prison planet forum discussing this , there is a a lot of evidence that they are gearing toward this...... . Alex: ....No - they admit Internet2, taxing the web, ending net neutrality, the headlines in Australia , Chinese style internet censorship . They’re doing it ...... They’re doing it..... Me: Yup, their doing it as we speak. And that is the thing Their doing IT NOW. This is happening now. We’re moving to Internet2 and ... as I’m.... ya know ... as I point out on the forum here -ya know - people are in the matrix....you don’t...... The average Joe doesn’t care about....ya know ... how the internet works it’s like is his TV.
AJ: And the elite Don’t care about him....and...
Me: ..Exactly.....
AJ: And ... And that’s the amazing issue. Thanks for the heads up. I’ll tell ya, our listeners give us all these heads up. .....
~~~~End Transcript~~~~~~~
Dude, I'm using this in the intro to my song 
|
|
|
|
|
Logged
|
 All proof of crimes against humanity under one roof... Activist tools for clarifying conspiracy realities NOW for all humanity and our liberty!
|
|
|
|
lordssyndicate
|
 |
« Reply #238 on: March 26, 2009, 12:46:46 AM » |
|
Dude, I'm using this in the intro to my song  Wow Thanks. Awesome. go right ahead. 
|
|
|
|
|
Logged
|
"Biotechnology it's not so bad. It's just like all technologies it's in the wrong HANDS!"- Sepultura
|
|
|
|
Anti_Illuminati
Guest
|
 |
« Reply #239 on: March 29, 2009, 08:35:46 PM » |
|
DECEMBER 17, 2002 SECURITY NETBy Alex SalkeverSoftware, Security, and EthnicityThe U.S. government's probe at software maker Ptech, owned by a Lebanese, has lots in common with the 1998 Wen Ho Lee case The 2,000-mile distance from the stark high desert of Los Alamos, N.M., to the high-tech office parks of Boston's suburbs appears to have shrunken dramatically in the past two weeks. I'm referring to the cases of Wen Ho Lee and Oussama Ziade. Both represent the federal government's fears that moles could work their way into the U.S. and achieve positions of trust that they later use to harm national interests. Whether Ziade is in fact such a mole seems unlikely, but expect the scenario playing out in Quincy, Mass., where his company, Ptech, is based, to be often repeated as the war on radical Islamic terrorists ramps up. The connection between Lee and Ziade? Call it the ghost of Christmas past. On Dec. 23, 1998, Lee, then a computer scientist at Los Alamos National Laboratory, failed a polygraph test. He had been working on semisecret nuclear weapons programs, and the lie-detector results sparked FBI concerns that China had used Lee to steal sensitive U.S. bomb plans. The scientist's eight-month incarceration left a noxious taste in the mouths of thousands of U.S.-based researchers of Chinese nationality or Chinese descent who had to take polygraph tests at the U.S. government's behest. Lee walked free in the end, but the specter of electronic espionage by foreign nations and terrorist groups has loomed large ever since. COLLATERAL DAMAGE. This holiday season, the FBI is on the case again, this time investigating Ptech, which makes software used to organize information by a host of clients including the U.S. Navy, the IRS, and many companies in the private sector. Ptech's CEO is Ziade, a Lebanese who has held U.S. citizenship for four years. Ziade, a Harvard-educated physicist, has a handful of employees of Middle Eastern ethnicity or family ties to predominantly Muslim countries, including Egypt. On Dec. 6, agents from the U.S. Customs Service and the FBI raided Ptech's offices as part of an investigation into whether the company has been used by a Saudi businessman now on the terrorism watch list to channel funds to al Qaeda. Although Ptech's software was not the initial target of the inquiry, as allegations built, Ziade found himself defending his product's integrity. Thus far, nothing untoward has been found in the software despite rigorous audits, and most experts discount any possibility that Ptech's code holds dangerous back doors that would allow unauthorized access to computer systems. As Lee found himself out of a job days before Christmas, Ziade may find himself in a similar situation. Two banks have closed Ptech accounts, the company claims. Several customers that were in the pipeline have told Ptech they would take a wait-and-see approach. "That's very difficult for a company trying to grow," says Greg White, an attorney representing the software maker. "CONTINGENCY PLANS." To boot, influential information-technology consultancy Gartner sent out a note warning its clients to steer clear of Ptech software due to concerns that it might not survive the fallout from the publicity. Wrote Gartner on Dec. 9: "Regardless of the eventual outcome, the federal investigation will strain Ptech's finances and divert its management team. Ptech customers should prepare contingency plans, such as obtaining escrow rights to the code and evaluate other vendors."Of course, neither situation represents an entirely black-and-white case of overzealous government paranoia. Lee brought classified files home against Los Alamos' and Energy Dept. rules. And while U.S. Justice Dept. investigators have said Ptech's software holds no back doors or other intentional security flaws tailor-made for spying, the Saudi Arabian businessman now on the Treasury Dept.'s watch list may have had some ties to funding that Ptech recieved for its operations in 1994. White points out that the Saudi man wasn't on any published lists of people financing terrorism at the time of the investments. Washington now finds itself in a familiar but uncomfortable position. The Lee case upset many talented researchers of Chinese ancestry or citizenry who were working for the U.S. government. Demoralized by the scrutiny, many of them left jobs at federal labs rather than undergo polygraph tests. CREDIBLE THREAT. By the same token, the Ptech affair has already cast a dark light upon the wide activities of Middle Eastern or Muslim computer programmers and software executives, many of whom are providing useful innovation to the U.S. and its allies. Witness Hossein Eslambolchi, the CTO of AT&T and holder of 87 patents who has played a key role in developing advanced fiber-optic data links.
Still, the possibility of an insider threat is credible on multiple levels. Israeli software programmers, most of whom learned their trade while serving in the military, occupy high-level positions at numerous computer-security software concerns in the U.S. Gil Shwed, one of the most influential people in the firewall business and the founder of industry leader Check Point Software (CHKP ), learned his trade in the Israeli Defense Force, and the company maintains research labs in Israel. Check Point declined to comment for this story.Likewise, former or current citizens of China have helped build some of the most sensitive information-security software in use today -- such as Feng Deng and Yan Ke, the founders of red-hot security-appliance maker NetScreen (NSCN ).HERCULEAN TASK. Could some of these coders be operatives for their respective intelligence services and be willing to plant back doors in software? To date no such cases have been reported at Check Point, NetScreen, or any other company. And any smart CIO who buys big, custom software projects requests the source code before installing such products. But auditing the source code of any significant piece of software is now an expensive, Herculean task. The likelihood of back doors inserted somewhere for spying purposes will only grow as the U.S., Israel, China, India, and a host of other countries both friend and foe expand their digital information-warfare operations. These operations aim to exploit technological weakness of opponents to gain military or economic advantage, and might include hacking into secret systems or economic espionage. "Any sort of vulnerability that has been implanted purposely in software can be exploited by a foreign adversary with very broad and potentially significant consequences," says Michael Vatis, the head of Information Security Technology Studies at Dartmouth College in Hanover, N.H.Adding to the risk is the increasingly blurry geography of software development. In recent months, several leading tech companies -- including Hewlett-Packard (HPQ ), IBM (IBM ), and others, have announced they would move more research and software development offshore to India, China, or elsewhere. This compounds the existing problem in vetting the billions of lines of code that now make up the digital guts of the global economy. After all, few companies have the resources to do any serious background checks of employees outside the U.S., especially in countries where the reliability of government records is suspect, and the information often incomplete.TRUSTWORTHY CODE. Also, while the U.S. government uses far stricter controls on software code in the military and other classified units, the boundaries between what's classified and unclassified are shrinking. To save money, the government is buying more off-the-shelf products. And info tech has standardized around the Internet and its XML protocols used to manipulate data. That means the differences between a word processor and a trusted security application are becoming less and less pronounced, making vetting issues all the more daunting. "The reality is the only code you can trust completely is code you wrote yourself," says Gary McGraw, chief technology officer of software-quality research company Cigital and author of the book Building Secure Software.That said, excessive paranoia on this issue could prove incredibly destructive to the U.S., chasing away valuable intellectual capital that the country sorely needs. The pendulum swung too far in that direction during the Lee case. And it appears to be swinging that way again with Ptech, given media coverage that has stoked fears of Al Qaeda software moles, even though Justice has said no evidence for any exists at Ptech. So how to strike a balance without striking a chord of McCarthyism and rolling out the polygraphs? For starters, a priority must be placed on building automated tools to audit code for possible back doors. That's a major challenge, considering the amazingly complex algorithms involved in most software today, and no tools that can rapidly handle large volumes of sophisticated code exist today. However, researchers are looking at ways to build such tools, according to Dartmouth's Vatis, and progress could come quickly in the near future, thanks to additional dollars now being thrown at the cybersecurity effort. HUMANS NEEDED. Another key step is not relying on any one company or product to protect computing infrastructures, according to Carl Landwehr, director of the Trusted Computing Program at the National Science Foundation. That runs somewhat counter to the trend of buying so-called security appliances that combine multiple programs on a single machine. But running several appliances should become less costly in the near future, and the basic security saw of "don't put all your eggs in one cyberbasket" is eminently sensible. Here's another key area that needs big improvements: actual on-the-ground intelligence. In a digital haystack, the dangerous needles may be more apparent to human brains that can follow a hunch and sift the information more effectively than even the slickest software tools. While Wen Ho Lee and now Oussama Ziade may shape the national security consciousness, the reality is that FBI mole Robert Hanssen, a seemingly normal U.S. citizen, did the most damage of any insider to date. For 15 years Hanssen turned over key U.S. intelligence information to the former Soviet Union and later to Russian operatives, exposing huge swathes of America's secret spying machinery. The inherent lesson is that high-tech spying, be it by foreign nationals or natives, will likely become a bigger problem. What's needed are better tools to detect these instances before they happen -- and less invasive ways to check the veracity of the code without singling out large groups of tech innocents who happen to have the wrong last name.
|
|
|
|
|
Logged
|
|
|
|
|