PrisonPlanet Forum
May 20, 2013, 09:19:12 PM *
Welcome, Guest. Please login or register.

Login with username, password and session length
 
   Home   Help Login Register  
Pages: [1]   Go Down
  Print  
Author Topic: Computers and Robots to Merge with Humans  (Read 12091 times)
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« on: March 03, 2008, 08:49:33 PM »

http://www.ananova.com/news/story/sm_2747077.html?menu=news.quirkies

Baby robot will be taught to talk

A university in Devon is set to find out if a 'baby' robot can be taught to talk.

Staff at the University of Plymouth will work with a 3ft humanoid robot called i Cub, reports the BBC.

Over the next four years, robotics experts will work with language development specialists who research how parents teach children to speak.

The project is believed to be the first of its kind in the world and could lead to the development of humanoid robots which learn, think and talk.

Experiments with iCub will include inserting objects of various shapes into the corresponding holes in a box, serialising nested cups and stacking wooden blocks.

The iCub, which will arrive at the university next year, will also be asked to name objects and actions so that it acquires basic phrases such as "robot puts stick on cube".

A consortium led by the University of Plymouth beat competition from 31 others to win a £4.7m grant for the Italk - Integration and Transfer of Action and Language Knowledge in Robots - project.

Angelo Cangelosi, Professor in Artificial Intelligence said: "The outcome of the research will define the scientific and technological requirements for the design of humanoid robots able to develop complex behavioural, thinking and communication skills through individual and social learning."
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
Brocke
Eleutherophiliac & Drapetomaniac
Global Moderator
Member
*****
Offline Offline

Posts: 9,403


I am not a number, I am a free man!


WWW
« Reply #1 on: March 18, 2008, 05:47:04 AM »

Controlling computers with Your Mind Now Possible
http://www.vidzest.com/media/366/Controlling_Video_Games_with_Your_Mind_Now_Possible/
Logged



That men do not learn very much from the lessons of history is the most important of all the lessons of history.
~Aldous Huxley
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #2 on: March 30, 2008, 01:47:59 PM »

http://blacklistednews.com/view.asp?ID=6049

A 'hospital' that's run entirely by robots!


Washington: The new 5 million dollars medical and surgical simulation training centre located at the Johns Hopkins Outpatient Center in East Baltimor, which opened in March, has some very unique new staff members - robots.
 
The 'sim' centre contains two fully operational ORs, two intensive care units (ICUs), high-fidelity computerized mannequins that mimic physiologic and behavioural response to procedures, and 12 examination rooms where students practice routine exams on actors posing as patients with particular complaints and symptoms.

The mannequins have breath sounds and heart tones, palpable pulses, and a monitor that displays vital signs as students, physicians, nurses and other health care professionals practice everything from bag-mask ventilation, intubation, and defibrillation to chest tube placement and endoscopies. Computer programs test decision-making skills and knowledge on topics such as advanced cardiac life support and trauma management.

"The idea is to get it right before they treat real patients," said Elizabeth Hunt, M.D., M.P.H., assistant professor in the Department of Anesthesiology and Critical Care Medicine and the centre's director.

The troupe of paid professional actors who are trained to portray patients submit themselves to trainees who practice taking histories, performing physical exams, breaking bad news and communicating in a compassionate manner.

"Students can learn the science of medicine in many different ways, but there is only one good way to learn good bedside manner, and that is with real people," said Hunt.

Each of the 15 simulation rooms in the centre is equipped with adjustable cameras, microphones, one-way glass for observer viewing, and large flat-screen monitors so students and staff can quickly review their performance while it's still fresh in their minds.

In addition to training students and staff, Hunt said that the centre will also be used to train medical staff on new equipment, and for teaching emergency medical technicians and paramedics.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
netizen_x
Member
*****
Offline Offline

Posts: 1,733


When Spider webs unite, they can tie up a lion


WWW
« Reply #3 on: April 01, 2008, 08:20:19 PM »

Quote
A team at Newcastle University announced yesterday that it had successfully generated “admixed embryos” by adding human DNA to empty cow eggs in the first experiment of its kind in Britain.

http://www.timesonline.co.uk/tol/life_and_style/health/article3663033.ece
Logged

"Since corrupt people unite amongst themselves to constitute a force, then honest people must do the same" ~ Leo Tolstoy
noname
Member
**
Offline Offline

Posts: 94


« Reply #4 on: April 02, 2008, 05:51:56 AM »


http://www.guardian.co.uk/science/2008/apr/02/medicalresearch.ethicsofscience
Logged
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #5 on: April 02, 2008, 06:43:19 PM »

http://news.bbc.co.uk/2/hi/technology/7325004.stm

Computers to merge with humans

By 2020 the terms 'interface' and 'user' will be obsolete as computers merge ever closer with humans.

It is one of the predictions in a Microsoft-backed report drawn from the discussions of 45 academics from the fields of computing, science, sociology and psychology.

It predicts fundamental changes in the field of so-called Human-Computer Interaction (HCI).

By 2020 humans will increasingly interrogate machines, the report said.

In turn computers will be able to anticipate what we want from them, which will require new rules about our relationship with machines.

Table map

The report, entitled Being Human: Human-Computer Interaction in the year 2020, looks at how the development of technologies over the next decade can better reflect human values.

"It is about how we anticipate the uses of technology rather than being reactive. Currently the human is not considered part of the process," said Bill Buxton, from Microsoft Research.

At the launch of the report some of the authors showed off the types of technologies that could bring the human back into the equation.

At Goldsmiths College, Professor Bill Gaver and his team have developed a Drift table, a piece of furniture which allows people to view aerial photography of their local neighbourhood and beyond.

"It isn't really designed for anything," explained Prof Gaver.

"People can use it for entertainment or learning. One of the people that was given the table used to check out houses in Southampton following a piece on the news about house prices going up in the area.

Someone else used it to look at the towns they lived in as a child or to visit towns where friends lived," he said.

The table has no buttons and the small display in the middle moves as a result of pressure being put on the table.

"From central London it would take a day to navigate the table to the coast," said Prof Gaver.

Other prototype technologies aimed at putting human need at the centre of the equation include the Whereabouts Clock.

The interface - designed by at Microsoft's research labs in Cambridge - allows family members to see where each other are at any given time.

The categories of 'home', 'work' and 'school' are deliberately vague in order to maintain privacy, explained Abigail Sellen, from Microsoft Research.

Other communication devices for the home that Microsoft is working on include Epigraph, an interface that allows family members to 'post' pictures and messages to each other via their mobile phones.

Smart devices

The keyboard, mouse and monitor will increasingly be replaced by more intuitive forms of interaction and display, including tablet computers, speech recognition systems and fingertip-operated surfaces.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #6 on: April 02, 2008, 08:37:52 PM »

http://www.guardian.co.uk/technology/2008/apr/03/news.advertising?gusrc=rss&feed=science

Neuromarketing could make mind reading the ad-man's ultimate tool

Neuroscience and marketing had a love child a few years back. Its name - big surprise - is neuromarketing, and the ugly little fellow is growing up. Corporate pitchmen have always wanted to get inside our skulls. The more accurately they can predict how we'll react to stimuli in the marketplace, from prices to packages to adverts, the more money they can pull from our pockets and transfer to their employers' coffers.

But picking the brains of consumers hasn't been easy. Marketers have had to rely on indirect methods to read our thoughts and feelings. They've watched what we do in stores or tracked how purchases rise or fall in response to promotional campaigns or changes in pricing. And they've carried out endless surveys and focus groups, asking us what we buy and why.

The results have been mixed at best. People, for one thing, don't always know what they're thinking, and even when they do, they're not always honest in reporting it. Traditional market research is fraught with bias and imprecision, which forces companies to fall back on hunches and rules of thumb.

But thanks to recent breakthroughs in brain science, companies can now actually see what goes on inside our minds when we shop. Teams of academic and corporate neuromarketers have begun to hook people up to functional magnetic resonance imaging (fMRI) machines to map how their neurons respond to products and pitches.

Last year, the journal Neuron published an article titled Neural Predictors of Purchases by a group of scholars from three leading US universities. The researchers described how they had used brain imaging to monitor the mental activity of shoppers as they evaluated products and prices on computer screens.

By watching how different neural circuits light up or go dark during the buying process, the researchers found they could predict whether a person would end up purchasing a product or passing it up. They concluded, after further analysis of the results, that "the ability of brain activation to predict purchasing would generalise to other purchasing scenarios".

The American business magazine Forbes heralded the study as a milestone in business, saying it marked the first time researchers have been able "to examine what the brain does while making a purchasing decision".

At McLean Hospital, a prestigious psychiatric institution run by Harvard University, an advertising agency recently sponsored an experiment in which the brains of half-a-dozen young whiskey drinkers were scanned. The goal, according to a report in Business Week, was "to gauge the emotional power of various images, including college kids drinking cocktails on spring break, twentysomethings with flasks around a campfire, and older guys at a swanky bar". The results were used to fine-tune an ad campaign for the maker of Jack Daniels.

A new group of high-tech consulting firms, with names like NeuroFocus and Neuroconsult, have sprung up to help companies deploy neuromarketing. The neuromarketers are playing a prominent role at Re:think, the Advertising Research Foundation's annual convention, held in New York this week. The New York Times reports its agenda is "filled with presentations" on the new scientific approaches to marketing.

In the future, marketers won't have to ask us what we think or try to decipher our intentions from our actions. They'll be able to monitor what we think directly - at the cellular level. That's good news for companies. Not only will they be able to spend their marketing budgets more efficiently, but they'll be able to wield more influence over the purchases we make.

The question, though, is when does influence become manipulation? If businesses can know more about what and how we think than we do ourselves, they'll also gain the power to control our perceptions and even our behaviour in ways we won't be able to detect. If it achieves even part of its potential, neuromarketing promises to tip the balance of power in the marketplace from the buyer to the seller.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #7 on: April 21, 2008, 07:29:15 PM »

http://www.guardian.co.uk/science/2008/apr/20/genetics.controversiesinscience

Biologists join the race to create synthetic life

Researchers will gather in London this week to outline plans to promote one of the most audacious, and controversial, scientific ideas of the 21st century - synthetic biology.

The new discipline, established by scientists such as human genome pioneer Craig Venter, involves stripping microbes down to their basic genetic constituents so they can be reassembled and manipulated to create new life forms. These organisms can then be exploited to manufacture drugs and fuels or to act as bio-sensors inside the body.

However, some researchers warn that synthetic biology - which is accelerating at a dramatic pace - also poses dangers. In particular, they fear it may already be possible to create deadly pathogens, such as polio or smallpox viruses, from pieces of synthetic DNA ordered over the internet. In future, completely new - and highly dangerous - microbes could be made this way.

'The major biotechnology companies that sell these DNA segments are careful to try to monitor their sale,' said Dr Philipp Holliger, of Cambridge University's Laboratory of Molecular Biology. 'Nevertheless, it is clear we need to have this field properly monitored.'

The crucial point, said Holliger, who will be speaking at this week's conference, Engineering Life, is that 'scientists are now learning how to design life down to the last letter. We don't know enough to be sophisticated as yet but our knowledge is increasing all the time.'

Most scientists working on synthetic biology projects - including Holliger - say that their research is safe and stress its potential benefits. 'Synthetic biology represents a new approach to engineering,' said Professor Richard Kitney of Imperial College London, another speaker at the meeting, which will debate the risks and ethics of synthetic biology. 'It has brought us to the cusp of a new industrial revolution in which new fuels, drugs, medical treatments and sensors can be created from biological materials.'

One idea is the creation of organisms that could soak up carbon dioxide from the atmosphere and turn it into hydrocarbon biofuels. In this way, synthetic life forms could play a major role in helping in the battle against global warming, it is claimed.

Engineering life is not new, scientists stress. It is the basis of the biotechnology and GM crop industries. But the technology involved in these disciplines is relatively crude. A single gene is inserted into a bacterium or plant which then churns out proteins made by that gene. By contrast, scientists working in synthetic biology strip down a bacterium's central genome - the DNA that directs its growth and development. Then they add new pieces of DNA to produce a microbe that can be tailored to do all sorts of different tasks. 'Essentially we are exploiting the leaps that have been made in understanding the different systems and processes that go inside an individual cell,' said Kitney.

It is a point backed by Professor John McCarthy, director of the Manchester Interdisciplinary Biocentre, at Manchester University. 'Novel circuitry has already been constructed inside a cell to generate biological devices that can act as sensors or which can help in the treatment of diseases such as malaria or the production of biofuels,' he said.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
Aqua Teen Hunger Force
Guest
« Reply #8 on: May 03, 2008, 10:25:54 PM »

The only solution to all this demonic technology is to REPENT, AND TURN TO THE SAVIOR JESUS CHRIST!
You can pack away every concievable survivalist contraption you want, ammo,weapons, food and go to the remotest parts in the wilderness, they will still come after you and --- well, I'll just let the bible speak for itself!

Matthew 24:8-13

All these [are] the beginning of sorrows.Then shall they deliver you up to be afflicted, and shall kill you: and ye shall be hated of all nations for my name's sake.And then shall many be offended, and shall betray one another, and shall hate one another.And many false prophets shall rise, and shall deceive many.And because iniquity shall abound, the love of many shall wax cold.But he that shall endure unto the end, the same shall be saved.

These are indeed perilous times we live in.And if you "patriots" think the N.W.O. is going to "shoot it out " with you man to man, then you are in for a big surprise.
They are going to literally fry you from a distance. Don't think for a minute that they won't, Just REPENT AND GET READY TO WATCH THE REWARD OF THE WICKED!
Logged
Div
Member
*****
Offline Offline

Posts: 667


Don't Tread On Me


« Reply #9 on: May 03, 2008, 10:35:50 PM »

Figures someone would jump in quoting the bible and talking of the end times.  Roll Eyes



Scientifically speaking this is interesting beyond words....... Unfortunately, we have to worry about it falling into the wrong hands. Stuff like this needs to be carried out with extreme caution.
Logged

Is a man not entitled to the sweat on his brow?
"No", says the man in Washington, "it belongs to the poor!"
"No", says the man in the Vatican, "it belongs to God!"
"No", says the man in Moscow, "it belongs to everybody!"
Aqua Teen Hunger Force
Guest
« Reply #10 on: May 06, 2008, 12:06:04 AM »

Figures someone would jump in quoting the bible and talking of the end times.  Roll Eyes



Scientifically speaking this is interesting beyond words....... Unfortunately, we have to worry about it falling into the wrong hands. Stuff like this needs to be carried out with extreme caution.

DDDuh, If you can't see it for what it is, then you are blind
Logged
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #11 on: May 15, 2008, 07:20:35 PM »

http://www.breitbart.com/article.php?id=D90M7EDO7&show_article=1

Robotic suit could usher in super soldier era

Rex Jameson bikes and swims regularly, and plays tennis and skis when time allows. But the 5-foot-11, 180-pound software engineer is lucky if he presses 200 pounds—that is, until he steps into an "exoskeleton" of aluminum and electronics that multiplies his strength and endurance as many as 20 times.

With the outfit's claw-like metal hand extensions, he gripped a weight set's bar at a recent demonstration and knocked off hundreds of repetitions. Once, he did 500.

"Everyone gets bored much more quickly than I get tired," Jameson said.

Jameson—who works for robotics firm Sarcos Inc. in Salt Lake City, which is under contract with the U.S. Army—is helping assess the 150-pound suit's viability for the soldiers of tomorrow. The suit works by sensing every movement the wearer makes and almost instantly amplifying it.

The Army believes soldiers may someday wear the suits in combat, but it's focusing for now on applications such as loading cargo or repairing heavy equipment. Sarcos is developing the technology under a two-year contract worth up to $10 million, and the Army plans initial field tests next year.

Before the technology can become practical, the developers must overcome cost barriers and extend the suit's battery life. Jameson was tethered to power cords during his demonstration because the current battery lasts just 30 minutes.

But the technology already offers evidence that robotics can amplify human muscle power in reality—not just in the realm of comic books and movies like the recently debuted "Iron Man," about a wealthy weapons designer who builds a high-tech suit to battle bad guys.

"Everybody likes the idea of being a superhero, and this is all about expanding the capabilities of a human," said Stephen Jacobsen, chief designer of the Sarcos suit.

The Army's exoskeleton research dates to 1995, but has yet to yield practical suits. Sarcos' technology sufficiently impressed Raytheon Co., however, that the Waltham, Mass.-based defense contractor bought Sarcos' robotics business last November. Sarcos also has developed robotic dinosaurs for a Universal Studios' "Jurassic Park" theme park ride.

Jack Obusek, a former colonel now with the Army's Soldier Research Development and Engineering Center in the Boston suburb of Natick, foresees robot-suited soldiers unloading heavy ammunition boxes from helicopters, lugging hundreds of pounds of gear over rough terrain or even relying on the suit's strength-enhancing capabilities to make repairs to tanks that break down in inconvenient locations.

Sarcos' Jacobsen envisions factory workers someday using the technology to perform manual labor more easily, and firefighters more quickly carrying heavy gear up stairwells of burning buildings. Disabled people also may find uses for the technology, he said.

"We see the value being realized when these suits can be built in great numbers for both military and commercial uses, and they start coming down in cost to within the range of the price of a small car," said Jacobsen. He declined to estimate how much the suit might cost in mass production.

But cost isn't the only obstacle. For example, developers eventually hope to lengthen the suit's backpack battery's life and tinker with the suit's design to use less energy. Meanwhile, the suit can draw power from a generator, a tank or helicopter. And there are gas engines that, while noisy, small enough to fit into the suit's backpack.

"The power issue is probably the No. 1 challenge standing in the way of getting this thing in the field," Obusek said.

But he said Sarcos appears to have overcome the key challenge of pairing super-fast microprocessors with sensors that detect movements by the body's joints and transmit data about them to the suit's internal computer.

Much as the brain sends signals to tendons to get muscles to move, the computer sends instructions to hydraulic valves. The valves mimic tendons by driving the suit's mechanical limbs, replicating and amplifying the wearer's movements almost instantly.

"With all the previous attempts at this technology, there has been a slight lag time between the intent of the human, and the actual movement of the machine," Obusek said.

In the demonstration, the bulky suit slowed Jameson a bit, but he could move almost normally. When a soccer ball was thrown at him, he bounced it back off his helmeted head. He repeatedly struck a punching bag and, slowly but surely, he climbed stairs in the suit's clunky aluminum boots, which made him look like a Frankenstein monster.

"It feels less agile than it is," Jameson said. "Because of the way the control laws work, it's ever so slightly slower than I am. And because we are so in tune with our bodies' responses, this tiny delay initially made me tense."

Now, he's used to it.

"I can regain my balance naturally after stumbling—something I discovered completely by accident."

Learning was easy, he said.

"It takes no special training, beyond learning to relax and trust the robot," he said.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
70983
Member
*****
Offline Offline

Posts: 1,655


http://www.conspiracyshirts.com/


« Reply #12 on: May 15, 2008, 07:30:23 PM »

So maybe Iron Man was hinting at something...I went to go see it Saturday.  All I got out of it was that Weapons Contractors are the good guys...hahahah
Logged

Ray McBerry for Governor of Georgia in 2010!  Reclaim the sovereignty of the States!

http://www.georgiafirst.org

Youtube Channel:  http://www.youtube.com/user/RayMcBerry

He has many informative videos advocating his candidacy.
Brocke
Eleutherophiliac & Drapetomaniac
Global Moderator
Member
*****
Offline Offline

Posts: 9,403


I am not a number, I am a free man!


WWW
« Reply #13 on: May 18, 2008, 07:02:39 PM »

Quote
So maybe Iron Man was hinting at something...I went to go see it Saturday.  All I got out of it was that Weapons Contractors are the good guys...hahahah

I saw Iron Man on the weekend and I thought it was good. I thought the Tony Stark character realized the error of his ways and wanted stop making weapons of destruction and death. Did I miss something?

I think the robotic suit is just the first stage. Their ultimate goal is to have remote controlled robots where the soldiers operating them are miles away from the real action.
Logged



That men do not learn very much from the lessons of history is the most important of all the lessons of history.
~Aldous Huxley
70983
Member
*****
Offline Offline

Posts: 1,655


http://www.conspiracyshirts.com/


« Reply #14 on: May 18, 2008, 07:06:04 PM »

the movie still put you under the "al-qaeda is coming to get you" spell

i wonder if his "arc-reactor" technology actually exists, too
Logged

Ray McBerry for Governor of Georgia in 2010!  Reclaim the sovereignty of the States!

http://www.georgiafirst.org

Youtube Channel:  http://www.youtube.com/user/RayMcBerry

He has many informative videos advocating his candidacy.
Pressed_Rat
Member
****
Offline Offline

Posts: 481


« Reply #15 on: May 18, 2008, 07:20:52 PM »

No, the ultimate goal is to merge humans with computers.  It's called transhumanism.



I saw Iron Man on the weekend and I thought it was good. I thought the Tony Stark character realized the error of his ways and wanted stop making weapons of destruction and death. Did I miss something?

I think the robotic suit is just the first stage. Their ultimate goal is to have remote controlled robots where the soldiers operating them are miles away from the real action.
Logged
lord edward coke
Member
*****
Offline Offline

Posts: 3,202


"Resistance to tyrants is obedience to God"


WWW
« Reply #16 on: May 19, 2008, 01:05:46 PM »

Figures someone would jump in quoting the bible and talking of the end times.  Roll Eyes



Scientifically speaking this is interesting beyond words....... Unfortunately, we have to worry about it falling into the wrong hands. Stuff like this needs to be carried out with extreme caution.
  falling into the "WRONG" hands Huh  it always gets to the wrong hands.  and we (u.s.) give it to em.
Logged

"Liberty has never come from government.  Liberty has always come from the subjects of government. The history of liberty is a history  of resistance. The history of liberty is a history of limitations of government power, not the increase of it." http://sedm.org/
lord edward coke
Member
*****
Offline Offline

Posts: 3,202


"Resistance to tyrants is obedience to God"


WWW
« Reply #17 on: May 19, 2008, 01:07:20 PM »

No, the ultimate goal is to merge humans with computers.  It's called transhumanism.



thats right the future is the borg as the nwo see it.
Logged

"Liberty has never come from government.  Liberty has always come from the subjects of government. The history of liberty is a history  of resistance. The history of liberty is a history of limitations of government power, not the increase of it." http://sedm.org/
Xill
Guest
« Reply #18 on: May 19, 2008, 02:21:16 PM »

History will see current days as the end of the industrialization period. I can tell you right now, after the technological atrocities that will take place during the current century there will be a major revolution followed by a massive anti-technology social system that will depend the less as possible on technology.

At that point the computer will be an antiquity like everything else, and people will realize how making stuff with their own hand as well as social interaction is what life is all about. The real future (not the near one) is not technological, it will start with a anti-technology revolution.
The candle still surpasses the light bulb, the paint and canvas still surpasses photoshop, acoustic musical instruments will always surpasses electric instruments,  and it will always remain this way.
Logged
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #19 on: May 21, 2008, 06:51:38 PM »

http://www.timesonline.co.uk/tol/news/politics/article3964693.ece

MPs back creation of human-animal embryos

British scientists will be allowed to research devastating diseases such as Alzheimer’s and Parkinson’s using human-animal embryos, after the House of Commons rejected a ban yesterday.

An amendment to the Human Fertilisation and Embryology Bill that would have outlawed the creation of “human admixed embryos” for medical research was defeated in a free vote by a majority of 160, preserving what Gordon Brown regarded as a central element of the legislation.

The Government is braced for defeat today, however, on a separate clause that would scrap the requirement that fertility clinics consider a child’s need for a father before treating patients. MPs will also consider amendments tonight that would cut the legal limit for abortion from 24 weeks to 22 or 20 weeks.

A second amendment, which would have banned the creation of “true hybrids” made by fertilising an animal egg with human sperm, or vice-versa, was also defeated yesterday by a majority of 63. Another free vote last night was expected to approve the use of embryo-screening to create “saviour siblings” suitable to donate umbilical cord blood to sick children.

Edward Leigh, Conservative MP for Gainsborough, moving the amendment to ban all admixed embryos, said that mingling animal and human DNA crossed an “ultimate boundary”. He said that exaggerated claims were giving patients false hope and that the dangers of the research were unknown. “In many ways we are like children playing with landmines without any concept of the dangers of the technology we are handling,” he said.

Mark Simmonds, a Shadow Health Minister, who moved the amendment to ban “true hybrids”, said that there was no compelling evidence of their research usefulness.

Evan Harris, the Liberal Democrat MP for Oxford West, challenged those who accepted admixed embryos in principle but rejected “true hybrids” to explain the ethical difference between an embryo that was 99 per cent human and one that was 50 per cent human.

Dawn Primarolo, the Health Minister, agreed: “Once we go down that road it seems illogical to oppose a particular mix.” Ms Primarolo said that the shortage of human eggs was the biggest barrier to embryonic stem cell research. The Minister admitted that the Bill was not a promise that cures for diseases could be found. “It is an aspiration that it may,” she said.

The amendment to ban all admixed embryos was defeated by 336 votes to 176. The prohibition on true hybrids was defeated by 286 votes to 223.

The main kinds of admixed embryo permitted by the Bill are “cytoplasmic hybrids” or “cybrids”, which are made by moving a human nucleus into an empty animal egg. These are genetically 99.9 per cent human. As well as true hybrids, it also allows chimeras that combine human and animal cells, and transgenic human embryos that include a little animal DNA.

The most immediate implication of the Commons vote will be to allow teams at the University of Newcastle upon Tyne and King’s College London, which already hold licences to create cybrids, to continue their research. Though they were cleared to start these experiments by the Human Fertilisation and Embryology Authority in January, their licences would have been rescinded had MPs voted for a ban.

Cybrids could carry the DNA of patients with genetic conditions to create stem-cell models of these diseases for studying their progress and testing new treatments. Human eggs could be used but are in short supply because of risk to donor women.

It is legal to culture admixed embryos up to 14 days and illegal to transfer them to a human or animal womb.

The decision will also encourage a third team, which plans to use admixed embryos to study motor neuron disease, to apply for a licence. The group, led by Professor Chris Shaw, of the Institute of Psychiatry in London, had been waiting for the vote.

Professor Shaw said: “It will allow us to forge ahead on all fronts in our attempts to understand and develop therapies for a huge range of currently incurable diseases. Cures may be some years off, but this vote does mean we can use hybrid embryos, in addition to adult stem cells, in our search to understand what causes Alzheimer’s, Parkinson’s and motor neuron disease.”

Professor Robin Lovell-Badge, of the National Institute for Medical Research in London, said the vote would aid understanding of normal embryonic development and of genetic disease: “This understanding will ultimately give us the best chance of developing therapies for these diseases, for infertility and for a range of other medical conditions”.

Simon Denegri, chief executive of the Association for Medical Research Charities, said: “MPs have clearly listened to the strong arguments put forward by medical research charities, patient groups and scientists of the importance of this research to advancing our understanding of diseases and conditions that affect hundreds of thousands of people in the UK.”

A majority of women say they should have the right to an abortion at between 20 and 24 weeks of their pregnancy and want the law to stay as it is. A poll of women of childbearing age, conducted by Ipsos MORI on behalf of Marie Stopes International found that 61 per cent say that there should be access to late abortion services for a wide range of circumstances.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #20 on: May 30, 2008, 05:49:04 PM »

http://news.yahoo.com/s/nm/20080529/us_nm/computer_mind_dc

Computer trained to "read" mind images of words

 WASHINGTON (Reuters) - A computer has been trained to "read" people's minds by looking at scans of their brains as they thought about specific words, researchers said on Thursday.

They hope their study, published in the journal Science, might lead to better understanding of how and where the brain stores information.

This might lead to better treatments for language disorders and learning disabilities, said Tom Mitchell of the Machine Learning Department at Carnegie Mellon University in Pittsburgh, who helped lead the study.

"The question we are trying to get at is one people have been thinking about for centuries, which is: How does the brain organize knowledge?" Mitchell said in a telephone interview.

"It is only in the last 10 or 15 years that we have this way that we can study this question."

Mitchell's team used functional magnetic resonance imaging, a type of brain scan that can see real-time brain activity.

They calibrated the computer by having nine student volunteers think of 58 different words, while imaging their brain activity.

"We gave instructions to people where we would tell them, 'We are going to show you words and we would like you, when you see this word, to think about its properties,"' Mitchell said.

They imaged each of the nine people thinking about the 58 different words, to create a kind of "average" image of a word.

"If I show you the brain images for two words, the main thing you notice is that they look pretty much alike. If you look at them for a while you might see subtle differences," Mitchell said.

"We have the program calculate the mean brain activity over all of the words that somebody has looked at. That gives us the average when somebody thinks about a word, and then we subtract that average out from all those images," Mitchell added.

Then the test came.

"After we train on the other 58 words, we can say 'Here are two new words you have not seen, celery and airplane."' The computer was asked to choose which brain image corresponded with which word.

The computer passed the test, predicting when a brain image was taken when a person thought about the word "celery" and when the assigned word was "airplane."

The next step is to study brain activity for phrases.

"If I say 'rabbit' or 'fast rabbit' or 'cuddly rabbit', those are very different ideas," Mitchell said.

"I want to basically use that as a kind of scaffolding for studying language processing in the brain."

Mitchell was surprised at how similar brain activity was among the nine volunteers, although the work was painstaking. For an MRI to work well, the patient must sit or lie very still for several minutes.

"It can be hard to focus," Mitchell said. "Somewhere in the middle of that their stomach growls. And all of sudden they think, 'I'm hungry -- oops.' It's not a controllable experiment."
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
Merlin
Member
*
Offline Offline

Posts: 21


« Reply #21 on: May 31, 2008, 09:11:03 PM »

Dear readers,
I was shocked when I read the article of the Daily mail reporter: Pupils 'will soon be able to download lessons directly into their brains' .

I think it is of the utmost importance to make objections to this technology as well as to the ethics of this policy.

First of all, I would like to tell you something about the functions of our brains in relation to learning, before I can explain how dangerous this technology will be.
I also would like to advise you to read the lecture 'Split brain' of Noble Prize winner Sperry, 1981.

We have a left and a right brain.
The left brain computes, follows protocol and procedures, and stores flat facts.
The right brain handles concepts, ideas, connects, relates, it qualifies information and feels.
Where the left brain creates the ability to speak (grammar protocol) and handles the flat meaning of words, the right brain understands what is said and how it is said (concepts and importance).
Together both halfs form a working unit, and if one half is injured the unit as a whole does not work properly, though the other, sound half retains all of its functions.

We live in a society where schooling is based upon two main learning principles: serialistic and holostic.
Serialistic learning could be associated with the left brain, and holistic with the right brain.
Most of the population will learn in the serialistic way (not Alex Jones however), and this means people will not easily question the information that is presented to them by authorities, but accept it as fact.

In fact, our entire society is dominated by serialism (no, not surrealism, but sure, okay), because everywhere we must follow bureaucratic protocol. And certainly on computers and internet as well.

Thus children are growing up in a society that shuts down a large part of the right brain. We all have to submit to that and from early on it is expected of us to put our trust in authorities (that decide what we learn).
This means that for a large number of people the right half of the brain remains underdeveloped, except for personal and private affections, but these are often surpressed.
In daily life this affect is often not applied to other information than the experiences in the private realms.

What we really need in our society is a learning system that is directed at both brain hemispheres, thereby creating a fully conscious human being who is inventive, introspective, and who can recognize patterns and processes (yes, Alex did well in his predictions).
Such a sytem would be nothing more than natural, because we are born with two interconnected halfs, not only the left side that has learned to be the representative of the whole world.

Up to the 1950s the right side of the brain was completely ignored, because authorities said it was retarded and subservient to the left brain.
Our schooling system were adjusted to that gross misassumption, and has never been altered since.
Things became only more bureaucratic, making things worse for the environment we grew up in.

This is why children are not conscious about the way they pick up information, they only learn because they have to.
Also, because of this, they have a low sense of self worth because they are simply not aware of their cognitive potential, which can almost be doubled by effective learning strategies (one half of a brain more!).
They lack self knowledge, go with the flow, and often lack the true creativeness that the early humans had naturally.
How many people feel that they are nothing compared to large multinationals and bureaucratic governments?

There are many good solutions, and one of them is the colorful work of De Bono; the six hats for creative thinking. This should be tought to children to make them natural human beings.

Now back to the technology these corporate scientists present.
Computers in our brain does not make us smarter or more inventive.
Actually, the proposed hardware could be catastrophically painful, because learning begins with our affection, not with flatly reproducing large lists of computer based protocols.
This friction could well drive our children crazy like a pepperoni onion.

This whole gross technological enterprise has the assumption that people behave like inferior calculators compared to computers.
It has the paradigm that humans are only good for following protocol.
Every computer expert can tell you that computers work with single, exact results that are based on single purposed algorithms (input, throughput, output).
No input, no output; computers are in fact dumb.
Also, information on discs, is flat information that has no personal or emotional quality to it.
Only software can produce 'intelligent' results, but the programmer controls the software.
In other words: who determines what will be stored in the head of our children, and how the software will be run from there?
And even every software has its own sofware protocols that must be followed - if I want to type this, I have to log in first, right?

These mad scientists will fail! fail big time!
The human mind does not work that way, and no computer part will enhance our intelligence, it will hurt as hell.

We are not machines, we are people who were born as people.
No system will ever win of the human mind.


If we learn our children complete learning skills and offer them a complete world of thoughts, they will be the very smart and ingenious generation of millions, and they will not be submitted because they are fully conscious of the world and aware of themselves.
It is within our reach, we just have to grab the opportunity.
Logged

CTGAATGGCCGAATTCGCCAGTCTTGGAAGACTCGA
Div
Member
*****
Offline Offline

Posts: 667


Don't Tread On Me


« Reply #22 on: June 10, 2008, 11:54:19 PM »

has anyone ever played deus ex? it has an interesting take on the transhumanist subject.


interesting philosphical discussion: http://www.youtube.com/watch?v=xBeoreJr4Yc&watch_response
one of the endings: http://www.youtube.com/watch?v=zeboqg4t9vs


interesting.
Logged

Is a man not entitled to the sweat on his brow?
"No", says the man in Washington, "it belongs to the poor!"
"No", says the man in the Vatican, "it belongs to God!"
"No", says the man in Moscow, "it belongs to everybody!"
Merlin
Member
*
Offline Offline

Posts: 21


« Reply #23 on: June 11, 2008, 09:06:00 PM »

It's fairly clear why every robot must look like a human being.
The hidden military goal is to produce infiltration units, and before that time units that look just like humans from a distance; the ultimate decoys.
Meanwhile, we get used to robot pets and robot servants, as if these are just nice family toys.

Heeey! Did you see that cool futuristic and trendy movie? Did you?
So humanoid robots will be the wanna-haves for the lonely y.u.p. of the future, won't they?
Logged

CTGAATGGCCGAATTCGCCAGTCTTGGAAGACTCGA
Ford
Member
****
Offline Offline

Posts: 450



« Reply #24 on: June 11, 2008, 09:09:07 PM »

Logged

Brocke
Eleutherophiliac & Drapetomaniac
Global Moderator
Member
*****
Offline Offline

Posts: 9,403


I am not a number, I am a free man!


WWW
« Reply #25 on: June 12, 2008, 05:06:38 AM »



SPEAKING OF...

The Humans Are Dead
http://www.youtube.com/watch?v=B1BdQcJ2ZYY&feature=related
Logged



That men do not learn very much from the lessons of history is the most important of all the lessons of history.
~Aldous Huxley
Div
Member
*****
Offline Offline

Posts: 667


Don't Tread On Me


« Reply #26 on: June 12, 2008, 11:46:41 AM »

http://www.youtube.com/watch?v=6hKG5l_TDU8&feature=related


LOL
Logged

Is a man not entitled to the sweat on his brow?
"No", says the man in Washington, "it belongs to the poor!"
"No", says the man in the Vatican, "it belongs to God!"
"No", says the man in Moscow, "it belongs to everybody!"
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #27 on: June 18, 2008, 05:47:44 PM »

http://www.financialpost.com/reports/story.html?id=594476

Japanese firm makes robot girlfriend for lonely men

TOKYO -- She is big-busted, petite, very friendly, and she runs on batteries.

A Japanese firm has produced a 38 cm (15 inch) tall robotic girlfriend that kisses on command, to go on sale in September for around US$175, with a target market of lonely adult men.

Using her infrared sensors and battery power, the diminutive damsel named "EMA" puckers up for nearby human heads, entering what designers call its "love mode."

"Strong, tough and battle-ready are some of the words often associated with robots, but we wanted to break that stereotype and provide a robot that's sweet and interactive," said Minako Sakanoue, a spokeswoman for the maker, Sega Toys.

"She's very lovable and though she's not a human, she can act like a real girlfriend."

EMA, which stands for Eternal Maiden Actualization, can also hand out business cards, sing and dance, with Sega hoping to sell 10,000 in the first year.

Japan, home to almost half the world's 800,000 industrial robots, envisions a US$10-billion market for artificial intelligence in a decade.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
Merlin
Member
*
Offline Offline

Posts: 21


« Reply #28 on: June 21, 2008, 10:15:12 PM »

has anyone ever played deus ex? it has an interesting take on the transhumanist subject.

interesting philosophical discussion: http://www.youtube.com/watch?v=xBeoreJr4Yc&watch_response


Well, to my knowledge there's a heavy mix up in politics and ideology on the one side and the workings of the human mind on the other.
It is the cultural and mental diversification of the human mind that makes new inventions and creativity possible by different insights.
This made the evolution of man.
Now that inventions (and their future, not too creative, upgrades) suffice for a global administering of power, no true inventions are needed any more. That is politics.
Creating a monoculture, and its inherent dependency on one powerstructure, is also politics.
These politics concern the degrading of human spirit and potential, and the justification that is used for this, is in fact conflicting politics/ideologies/interests that are causing poverty and war.
Not because the human mind itself is bad or imperfect, as is said by the supercomputer in the game.
It is these politics/interests of commercial globalisation that are taken for granted and that are also put forward as inevitable and good things by this supercomputer.
The writer of the game made a story line, but built in assumptions that are THE standards in our current multinational society.
Classic case of a blind spot, or perhaps some proof of our schooling that creates lack of sensitivity?
Logged

CTGAATGGCCGAATTCGCCAGTCTTGGAAGACTCGA
Merlin
Member
*
Offline Offline

Posts: 21


« Reply #29 on: June 21, 2008, 10:37:27 PM »

O yes, and that brings me to the following point:
In fact this supercomputer propagates violence.
How? By foisting the ideology of a global monoculture.
The computer has become all powerful and its will is law...and all should submit.

Then we can look at the current programme of IBM, using games to create the tomorrow leaders of the world.
These are RPG's, but all of them propagate the use of fighting tactics and weapons - of course made attractive in mythical rainbow colours.
It's the fighting law of the concrete jungle, better known as corporate competition on a global scale (This is the standard taken for granted in Deus Ex's supercomputer).
The author of these RPG's are the true leaders, not the subjects that should make the 'leaders of tomorrow' according to IBM.
These authors have the power to make all role playing people behave in a certain way; behave according to the protocols of the game, and create conditions wherein group conscience will show certain predictable behaviours that flow from these conditions.
True power lies in the hands of the authors.
They will be the architects of human behaviour, if people take the quality of the prearranged conditions for granted.
Logged

CTGAATGGCCGAATTCGCCAGTCTTGGAAGACTCGA
Brocke
Eleutherophiliac & Drapetomaniac
Global Moderator
Member
*****
Offline Offline

Posts: 9,403


I am not a number, I am a free man!


WWW
« Reply #30 on: June 22, 2008, 02:43:45 AM »

Colossus, The Forbin Project
http://www.youtube.com/watch?v=-RdHuCyjqKw

This was a brilliant trilogy of novels the tv mini series was ok.


The voice of Colossus had a guest spot here
http://www.youtube.com/watch?v=GDS83yrM30Y
Logged



That men do not learn very much from the lessons of history is the most important of all the lessons of history.
~Aldous Huxley
Div
Member
*****
Offline Offline

Posts: 667


Don't Tread On Me


« Reply #31 on: June 30, 2008, 12:23:29 AM »

O yes, and that brings me to the following point:
In fact this supercomputer propagates violence.
How? By foisting the ideology of a global monoculture.
The computer has become all powerful and its will is law...and all should submit.

Then we can look at the current programme of IBM, using games to create the tomorrow leaders of the world.
These are RPG's, but all of them propagate the use of fighting tactics and weapons - of course made attractive in mythical rainbow colours.
It's the fighting law of the concrete jungle, better known as corporate competition on a global scale (This is the standard taken for granted in Deus Ex's supercomputer).
The author of these RPG's are the true leaders, not the subjects that should make the 'leaders of tomorrow' according to IBM.
These authors have the power to make all role playing people behave in a certain way; behave according to the protocols of the game, and create conditions wherein group conscience will show certain predictable behaviours that flow from these conditions.
True power lies in the hands of the authors.
They will be the architects of human behaviour, if people take the quality of the prearranged conditions for granted.



i think you're reading it the wrong way. as far as the game itself goes, you can reject his ideas and just kill him if you want, or go help a different group instead.

but the plan he had for humans was to release nanobots into the air that would assimilate with the people and link their brains up with itself. then the government would work by having the computer listen to everyones thoughts and make desicions accordingly to what they want, putting priority on minds that are rational and informed. ideally, it means that the government would be made up of every single person on the planet, the government would actually be the people as opposed to representatives of the people.

of course, u can choose to help other factions instead of him. you can join the illuminati and keep the world going business as usual, you can help a group of fanatics who want to eliminate all modified humans from the planet, or join the fourth group who kills all of them.

computer ending - http://www.youtube.com/watch?v=zeboqg4t9vs
illuminati ending - http://www.youtube.com/watch?v=dIX0BIuRYGo&feature=related
fanatic ending  - http://www.youtube.com/watch?v=wcCGGracpCw&feature=related
doomsday ending - http://www.youtube.com/watch?v=rLMn3_SzBiU&feature=related
Logged

Is a man not entitled to the sweat on his brow?
"No", says the man in Washington, "it belongs to the poor!"
"No", says the man in the Vatican, "it belongs to God!"
"No", says the man in Moscow, "it belongs to everybody!"
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #32 on: July 07, 2008, 09:59:29 AM »

http://www.livescience.com/technology/080705-artificial-dna.html

Breakthrough: Artificial DNA Could Power Future Computers

Chemists claim to have created the world's first DNA molecule made almost entirely of artificial parts.

The finding could lead to improvements in gene therapy, futuristic nano-sized computers, and other high-tech advances, the Japanese researchers say.

DNA, popularly illustrated as a double helix, holds the blueprints of life and controls what every living organism becomes and how it functions.

Scientists have tried for years to develop artificial versions of DNA in order to take advantage of its amazing information storage capabilities. Already, DNA has been harnessed to create simple electronic circuits.

DNA uses just four basic building blocks, known as bases, to code proteins used in cell functioning and development. Other researchers have crafted DNA molecules with a few artificial parts.

But Masahiko Inouye and colleagues at the University of Toyama used stitched together four entirely new, artificial bases inside the sugar-based framework of a DNA molecule, creating unusually stable, double-stranded structures resembling natural DNA, they say.

Like natural DNA, the new ripoffs were right-handed and some easily formed triple-stranded structures. "The unique chemistry of these structures and their high stability offer unprecedented possibilities for developing new biotech materials and applications," the researchers said in a statement.

The breakthrough will be detailed in the July 23 issue of the Journal of the American Chemical Society.

"The artificial DNA might be applied to a future extracellular genetic system with information storage and amplifiable abilities," the researchers write.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
DCUBED
Moderator
Member
*****
Offline Offline

Posts: 3,882


Sieg Heil!


« Reply #33 on: July 07, 2008, 04:42:49 PM »

http://blacklistednews.com/news-338-0-0-0--.html

Scientists Identify Genes that Could Turn People into Supergeniuses / Mindless Drones

It's clear that there's a specific set of genes responsible for brain development when you're in the womb, and that those genes affect your ability to learn later on. But now a group of researchers in the U.S. and Canada have identified those genes. And their discovery could represent the first step in tweaking brain development. It's possible that that knocking out some of those genes or adding extra copies of them to a developing baby could result in the tailor-made human minds of Brave New World: Some will be born to develop cutting-edge technologies, and others to be slow-witted and compliant.

Published this weekend in PLoS Genetics, the study is extraordinary not just because of its futuristic implications, but because of the cool new super-rapid system the researchers used to identify which genes are active during brain development. The technique is called RNA interference, or RNAi:

    Dr. Katharine Sepp and her fellow researchers took fresh neuronal cells extracted from embryos of the fruit fly genus Drosophila and screened them using RNA interference techniques. The team tested all genes, one by one in a rapid manner, for their potential role in neuronal development. The team then validated the method in mice.

    A combination of live-cell imaging and quantitative analysis allowed Sepp et al to characterize neurons’ morphological phenotypes in response to RNAi-mediated gene knockdown. The researchers focused on 104 evolutionary conserved genes that, when downregulated by RNAi, have morphological defects. The team developed algorithms to help streamline the analysis of the thousands of images created in the process.

    The analysis revealed unexpected, essential roles in neurite outgrowth for genes representing a wide range of functional categories including signalling molecules, enzymes, channels, receptors, and cytoskeletal proteins. Results also determined that genes known to be involved in protein and vesicle trafficking show similar RNAi phenotypes.

    The researchers believe that this study provides an effective method for future studies of a large variety of genes, including those with important functions in the nervous system.

This research will open up new ways to tinker with brain development, but right now the genes have only been identified in flies and mice. Humans share a lot of genes with both creatures. Still, don't expect to order your supergenius baby next week. Or your army of slave drones.
Logged

“Once you eliminate the impossible, whatever remains, no matter how improbable, must be the truth.”  - Arthur Conan Doyle

"The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists." J. Edgar Hoover
Brocke
Eleutherophiliac & Drapetomaniac
Global Moderator
Member
*****
Offline Offline

Posts: 9,403


I am not a number, I am a free man!


WWW
« Reply #34 on: July 08, 2008, 06:20:16 PM »

Hmm, DNA computers. Once they are living things then they will be "allowed" rights. Who know where that could lead...no where good I'm sure.
Logged



That men do not learn very much from the lessons of history is the most important of all the lessons of history.
~Aldous Huxley
Pages: [1]   Go Up
  Print  
 
Jump to:  

Powered by MySQL Powered by PHP Powered by SMF 1.1.17 | SMF © 2011, Simple Machines Valid XHTML 1.0! Valid CSS!