YOU CANNOT MAKE THIS STUFF UP!!!http://www.mitre.org/news/digest/advanced_research/02_09/genes.html(See above link for a pic of a bunch of scumbags who work for the NWO, not gonna bother posting it here until it gets appropriately photoshopped 1st.)
Hunting Dangerous Genes,
Inbox by InboxFebruary 2009
The building blocks for deadly bio-weapons are available by email or online to almost anyone who cares to place an order—and the world has begun to pay attention. "Current government oversight of the DNA-synthesis industry falls short of addressing this unfortunate reality," wrote a group of academics, industry executives, and security experts in a 2007 article, "DNA Synthesis and Biological Security," which appeared in the journal Nature Biotechnology.
Addressing that scary scenario head-on is a group of MITRE experimental and computational biologists developing a method for weeding out dangerous synthetic DNA orders from harmless ones.
They call their fledgling process DOTS, short for DNA Order Tracking System. And with the success of an early prototype, they now have set their sights on making DOTS available outside of the laboratory.
Some background: Genetic materials made to order from the basic chemical components of DNA are now routinely manufactured by dozens of companies in the United States and abroad.
Anyone can place an email order with these DNA synthesis companies for any combination of genetic base pairs A, T, G, and C and have the order delivered. (Please see "The ABCs of ATGC," on this page.) It's also cheap: costs for DNA synthesis have fallen from $30 per base pair in 1990 to roughly 55 cents per base pair today.
So far, one factor limiting easy abuse of factory-made genetic materials is that no manufacturer has yet been able to make a DNA sequence longer than 35,000 base pairs. Because a virus like Variola major, which causes smallpox, contains 190,000 base pairs of DNA, some feel comfortable that would-be bioterrorists can't readily order such dangerous pathogens.
"Don't be so comfortable," warns John Dileo, experimental biologist and MITRE's lead in the DOTS project. "Small lengths of DNA can be ordered from multiple manufacturers and then stitched together" to make a potentially deadly virus.MIT's Drew Endy, a leading authority on synthetically engineered pathogens, offered a simpler "genetic hack" to the audience at the 24th Chaos Congress in Berlin in 2007: "You can add key genes to an otherwise harmless but close relative to the virus" and thereby convert it to a virulent pathogen. Dileo, citing a sobering example, reckons that the ultra-deadly genome of the Ebola virus, which is fewer than 19,000 base pairs, would cost a mere $8,500 to manufacture.
Siloed Checks Provide No Safeguard
In 2005, researchers at the U.S. Centers for Disease Control and Prevention (CDC) in Atlanta, Ga., showed just how easy this process can be. They placed email orders to purchase many different DNA sequences from several manufacturers and then stitched those sequences together, thereby recreating the virus that caused the 1918 flu pandemic that killed 40 million people worldwide. Thankfully, these were the good guys—but what if they weren't?James Diggans, Dileo's colleague and DOTS co-developer, cites published reports showing that virtually all DNA synthesizers have some kind of screening system in place to "systematically check their orders and ensure that they are not constructing and delivering dangerous DNA sequences." These screening systems, however, are designed to detect orders for large segments (more than 300 base pairs) of DNA from a single vendor. A bad actor ordering smaller segments from multiple vendors for later assembly into an infectious agent would go unnoticed, and it is this shortcoming that the DOTS system addresses.
Though a new industry, DNA synthesis is a burgeoning one. In the U.S. alone, manufacturing requests are on track to top more than 15 million orders a month by 2012, up from 9 million a month just two years ago. Overwhelmingly, the orders are from trusted government, private, and university laboratories that use the synthetic DNA for legitimate research.
However, it's an order stream that is not monitored across companies in an industry that's essentially unregulated. As such, the potential for danger by those committed to the covert production of biological weapons remains unaddressed.A recent survey conducted by the publication New Scientist found wide divergence in industry reaction to overseeing questionable DNA orders. "It's not our job," reported the director of Genemed Synthesis in California. The general manager at Bio Basic in Canada admitted only to spot-checking orders. Conversely, the president of Blue Heron in Bothell, Wash., claims that his company checks every order. And Picoscript of Houston, TX, turned down an email order from a reputable U.S. laboratory when it learned that the order was to be shipped to an unknown third party in a foreign country. For Dileo and Diggans, the lack of uniformity and siloed nature of these companies' policies is insufficient to address the threat posed by the technology.
Developing a Hard-to-Evade System
For three years now, DNA synthesizers' only defense against such orders—other than scrutinizing their own in-boxes—has been freely available software from a West Coast software development company. According to the developer, the software is "designed to identify DNA and protein sequences derived from hazardous biological agents," tracking potential problems by uploading the ordered sequence and matching them against select agents in the National Institutes of Health's GenBank genetic sequence database.
However, "the software can be evaded by breaking select agent sequences into short segments and ordering from a number of synthesis companies allowing intent to fly under the radar," contends MITRE's David Walburger, another of the DOTS researchers. That's where DOTS comes into play, say Dileo and Diggans. They recently co-presented their new order-checking software at a MITRE Lecture Series event on bio-security. They reported that DOTS scrutinizes DNA sequences from both the black list as well as a "grey list," made up of DNA sequences that could be either virulent or harmless depending on how they are used. The system also checks the additional details found in every order, such as buyer information, shipping, and other relevant data. This information becomes the input for specially designed algorithms to calculate a threat score for any one order or collection of orders. DOTS processes and re-processes the orders in the database looking for collections of DNA strings that, if stitched together, could be hazardous.
To date, the DOTS prototype can efficiently process 10,000 orders at a time on a single processor, with each screened order ranging from 20 to 300 base pairs in length. Of course, checking 10,000 orders is a far cry from the 15 million orders a month worldwide expected by 2012. The goal now is to scale up DOTS and move to a computing cluster to meet that demand.
"Based on past experience," notes Dileo, "within the next two or three years some federal agency will be given a national security mandate to be responsible for monitoring and regulating recombinant and synthetic DNA activities." Well in advance of that looming directive, the MITRE DOTS team feels confident that their DNA Order Tracking System will be ready for use by government and industry partners.
The ABCs of ATGC
The English alphabet's 26 letters can combine to form enormous numbers of meaningful expressions. "I am brewer's yeast" uses 15 letters and an apostrophe. Similarly, DNA has an alphabet, but one consisting only of four letters: A,T,G, and C. Using these four letters, DNA can spell out the genetic sequence for any living organism or any parts thereof.
Below is the bare beginning of the DNA's spelling for brewer's yeast. When finished, the sequence will contain nearly 13 million distinct letters all from the DNA alphabet.
AACAAGATGCCATTGTCCCCCGGCCTCCTGCTG CTGCTGCTCTCCGGGGCCACGGCCACCGCTGCC CTGCCCCTGGAGGGTGGCCCCACCGGCCGAGAC AGCGAGCATATGCAGGAAGCGGCAGGAATAAGG AAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGG TTTGAGTGGACCTCCCAGGCCAGTGCCGGG...
Each letter in the DNA alphabet represents four distinct chemical substances called nucleotide bases. The letter A stands for the chemical base adenosine, while C is for cytosine; G is for guanine; and T is for thymine. These sequences of DNA bases are used to make up genetic factory orders; instructions that the body’s ribosomes will then follow to manufacture the necessary proteins that maintain all biological functions.
The key to modern genetics is "sequencing" those bases: figuring out the makeup of each gene by splitting the gene into multiple fragments in order to determine the exact order of the nucleotides. Once a gene's ATGC sequence has been revealed, it's then possible to manufacture those gene sequences artificially in a laboratory. And since 2005, a gene "synthesizing" industry that manufactures complete gene sequences as well as shorter lengths of DNA for a variety of applications has sprung up worldwide to do just that.
While naturally occurring genetic structures remain the research province of microbiologists and geneticists, separating and recombining "synthesized" DNA into new or novel genetic structures is the domain of synthetic biologists. Hence, it was synthetic biology that recreated the deadly 1918 flu virus from snippets of base pairs. Similarly, synthetic biology is at the root of the experimental drug MT103, a vaccine engineered via computer simulation that convinces the body's immune system to hunt down and destroy cancer cells. And synthetic biologists may well be the ones who ultimately manipulate DNA sequences and living systems into workarounds for—or total elimination of—many of the more than 4,000 inherited genetic diseases that plague human health.
